Linear Amplification Mediated PCR for the retrieval of lentiviral vector integration sites from tumors induced by insertional mutagenesis.

doi:10.1038/protex.2013.009

Method Article

Linear Amplification Mediated PCR for the retrieval of lentiviral vector integration sites from tumors induced by insertional mutagenesis.

https://doi.org/10.1038/protex.2013.009

This work is licensed under a CC BY-NC 3.0 License

This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.

Version 1

posted

You are reading this latest protocol version

Linear Amplification Mediated (LAM) PCR is a method to retrieve the integration sites of different integrating vectors into the genome^1-3. A PCR product that starts from the known sequence of the vector and extends through the unknown flanking genome is generated and sequenced to identify the position within the genome of the vector integration. Here we describe the adaption and exploitation of LAM-PCR for the retrieval of lentiviral vector (LV) integrations from oligoclonal hepatocellular carcinomas induced by LV-based insertional mutagenesis⁴.

Biotechnology

Biological techniques

Molecular Biology

Vector integration

insertional mutagenesis

lentiviral vector

retrieval of vector integration

integrating vector

LAM-PCR

Insertional mutagenesis approaches use oncoretroviruses or transposons to trigger cancer in mice by widespread integration into the cellular genome and activation of oncogenes near the integration site. Mapping the genomic integration sites in tumors allows the identification of genomic regions that are recurrently hit in independent tumors (defined as Common Insertion Sites, CIS)⁵, which host genes likely involved in cancer development⁶.

We have recently developed a new specifically tailored LV-based insertional mutagen that allowed the induction of hepatocellular carcinoma in 3 different mouse models⁴. In order to identify the integration sites from LV-induced tumors and control nontumoral samples, we exploited LAM-PCR¹ followed by 454 pyrosequencing. The analysis of LV integrations in tumors allowed the identification of 4 new liver cancer genes. Here we describe how we applied the LAM-PCR protocol1 for the retrieval of LV integrations from the hepatocellular carcinomas induced in our cancer gene discovery screening.

Application of this protocol to oligoclonal tumors induced by insertional mutagenesis may optimize the overall retrieval of integrations which are responsible for the cellular transformation and minimize the detection of integrations that occurred in the tumor stroma or in the parenchymal nontumoral cells that can be collected within the tumoral mass together with neoplastic cells.

Reagents

Taq DNA polymerase (Qiagen)

dNTPs (Fermentas)

Magnetic particles: Dynabeads M-280 Streptavidin (Dynal/Invitrogen)

Kilobase binder kit (Dynal/ Invitrogen)

Klenow polymerase (Roche)

Hexanucleotide mixture (Roche)

Restriction endonuclease: HPYCH4IV and TSP509I and incubation buffer (New England Biolabs)

Fast-Link DNA ligation kit (Epicentre)

Spreadex EL1200 precast gel (Elchrom Scientific)

QIAquick PCR purification kit (Qiagen)

DNA extraction kit (Qiagen or Roche)

Primers for amplification reactions (MWG Biotech) Sequence (5’ to 3’):

LTRIa: GAGCTCTCTGGCTAACTAGG

LTRIb: GAACCCACTGCTTAAGCCTCA

LTRII: AGCTTGCCTTGAGTGCTTCA

LCI: GACCCGGGAGATCTGAATTC

LTRIII: AGTAGTGTGTGCCCGTCTGT

LCII: AGTGGCACAGCAGTTAGG

Oligonucleotides for the generation of linker cassette; Sequence (5’ to 3’):

‘Long’ Oligonucleotide LC1: GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGG

‘Short’ Oligonucleotide (Tsp509I: |AATT) LC3: AATTCCTAACTGCTGTGCCACTGAATTCAGATC

‘Short’ Oligonucleotide HpyCH4IV: A|CGT) LC5: CGCCTAACTGCTGTGCCACTGAATTCAGATC

Equipment:

Hood for molecular biology such as Steril-Gemini (Angelantoni)

Magnetic particle concentrator (MPC; MPC-E-1; Dynal)

Microcon-30 (Millipore)

Submerged gel electrophoresis apparatus SEA 2000 (Elchrom Scientific)

Thermocycler programmed with the desired protocols such as Biometra (Thermo) or Mycycler (Biorad)

Horizontal shaker Unimax 2010 (Heidolph)

Gel documentation system (PeqLab)

Procedure

Perfom DNA extraction and any following step of sample processing (diluition, quantification,…) in a dedicated hood for molecular biology in order to avoid any contamination.
Before starting the LAM-PCR procedure, the DNA extracted from the tumor (or the control sample) has to be used for the determination of the vector copy number (VCN) per diploid genome in the sample of interest as described. Briefly, for LV–transduced samples, quantitative Taqman PCR was performed using control samples with known vector copy number (defined with a different approach, such as Southern Blotting) ³
Set up a 50-μl reaction linear PCR initiated from 5′-biotinylated vector-specific primer LTRIa and LTRIb as follows:

10× Taq polymerase reaction buffer 5 μl

Template DNA (0.01–10,000 ng) x μl

dNTPs (200 μM each) 1 μl

Taq polymerase (2.5 U/μl) 0.5 μl

Primer LTRIa (0.5 pmol/μl) 0.25 μl

Primer LTRIb (0.5 pmol/μl) 0.25 μl

dH2O 43 – x μl

To favor the amplification of integrations occurring in the putatively oligoclonal tumor parenchyma over the ones occurring in the tumoral stroma and contaminating surrounding tissue, we used an ad hoc–designed LAM-PCR amplification protocol that uses limiting amounts of DNA to favor the amplification and retrieval of dominant insertions. The optimal amount of DNA for tumoral samples was defined empirically by using different quantities of DNA from tumors with a previously measured VCN. Since we expect the tumors to be mono or oligoclonal, we chose the minimal DNA quantity that resulted in the generation of few discrete bands, each representing a different LV insertion

(Fig.1)

According to these criteria, for tumor samples we used different amounts of DNA as template for LAM-PCR, according to the VCN that was detected in the sample by qPCR: 100 ng if VCN < 1; 50 ng if VCN ≥ 1 and ≤ 3; 10 ng if VCN > 3. For nontumoral samples, 100 ng of DNA was always used as template for LAM-PCR.

Perform the linear amplification (assembled as described above) using the following PCR program.
Initial denaturation 95°C 5’

a) Denaturation 95°C 1’

b) Annealing 60°C 45’’

c) Elongation 72°C 1’30’’

Repeat from a) to c) for 25 cycles

Final Elongation 72°C 10’

Perform the Magnetic capture, Double-stranded DNA synthesis, Restriction Digest, Linker Ligation, Denaturation and Nested PCR as described in the canonical LAM-PCR protocol¹ using oligos for HIV-derived lentiviral vectors.
For visualization of the LAM-PCR products, separate 5 μl of the second exponential amplification on a high-resolution Spreadex gel according to the manufacturer’s recommendations
(Fig. 2)
.
Products of the second exponential amplification were tagged and then sequenced at high throughput with the 454 GS Flx platform (Roche). For these oligoclonal hepatocellular carcinomas, an average of 300 sequencing reads for each of the 2 PCR products (digested respectively with Tsp509I and HpyCH4IV) were performed, and resulted in the univocal mapping of an average of 6 integrations per sample⁴.

The overall procedure to obtain PCR products requires 3 working days.

Negative control sample for each of the amplification step (reagent without template DNA for linear amplification, 1st exponential amplification and 2nd exponential amplification, see

Fig. 1

) should be included to check for contaminations.

A representative output for a panel of hepatocellular carcinoma with different VCN is presented in

Figure 2.

Schmidt, M. et al. High-resolution insertion-site analysis by linear amplification-mediated PCR (LAM-PCR). Nature methods 4, 1051-7 (2007).
Montini, E. et al. The genotoxic potential of retroviral vectors is strongly modulated by vector design and integration site selection in a mouse model of HSC gene therapy. J Clin Invest 119, 964-75 (2009).
Montini, E. et al. Hematopoietic stem cell gene transfer in a tumor-prone mouse model uncovers low genotoxicity of lentiviral vector integration. Nature biotechnology 24, 687-96 (2006).
Ranzani, M. et al. Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer. Nature methods (2013).
Abel, U. et al. Real-time definition of non-randomness in the distribution of genomic events. PLos One 2, e570 (2007).
Kool, J. & Berns, A. High-throughput insertional mutagenesis screens in mice to identify oncogenic networks. Nature reviews. Cancer 9, 389-99 (2009).

We would like to acknowledge all the people involved in the project published in Nature Methods: Bartholomae CC, Sanvito F, Pala M, Sergi Sergi L, Bulfone A, Doglioni C, von Kalle C, Kim YJ, Schmidt M, Tonon G.

The authors declare no competing financial interets

Download PDF

Version 1

posted

You are reading this latest protocol version

Linear Amplification Mediated PCR for the retrieval of lentiviral vector integration sites from tumors induced by insertional mutagenesis.

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Timing

Troubleshooting

Anticipated Results

References

Acknowledgements

Additional Declarations

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Linear Amplification Mediated PCR for the retrieval of lentiviral vector integration sites from tumors induced by insertional mutagenesis.

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Timing

Troubleshooting

Anticipated Results

References

Acknowledgements

Additional Declarations

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Manage Cookie Preferences