Method Article
Single-cell multi-omic profiling of chromatin conformation and DNA methylation
Jesse R Dixon
Salk Institute for Biological Studies
Corresponding Author
ORCiD: https://orcid.org/0000-0002-6273-2181
Joseph R Ecker
Salk Institute for Biological Studies
Corresponding Author
ORCiD: https://orcid.org/0000-0001-5799-5895
Abstract
The ability to profile epigenomic features in single cells is facilitating the study of the variation in transcription regulation at the single cell level. Single cell methods have also facilitated the generation of cell-type resolved transcriptomic and epigenetic profiles of lineages derived from complex heterogeneous samples. However, integrating different epigenetic features remain challenging, as many current methods profile a single data type at at time. Furthermore, some epigenetic features, such as 3D genome organization, are intrinsically variable between single cells of the same lineage, so it remains unclear how well these methods may resolve cell-types from complex mixtures. Here we describe a method for profiling 3D genome organization and DNA methylation in single cells. This protocol accompanies Lee et al. (Nature Methods 2019) after peer review to aid potential users in applying the method to their own samples.
Keywords
Single Cell, 3D genome, DNA methylation, chromatin, epigenetics, genomics
Figures
Figure 1
Figure 2
Introduction
Three-dimensional genome architecture is a critical feature of gene regulation in metazoan organisms 1–3. Despite the increasing utility of these datasets, most existing chromatin conformation maps are generated from cell lines in vitro or from bulk tissues in vivo 4–8. While cell line data has enabled a greater understanding of the general principles of chromatin organization, it cannot fully represent the diversity of cell types that arise in vivo. Recent efforts using single-cell “omics” technologies aims to resolve this challenge by generating single-cell data from complex tissues that are then partitioned into the relevant distinct cell types in silico using data dimensionality reduction and clustering algorithms 9–12. However, it remains unclear whether single-cell Hi-C profiles will be suitable for partitioning into constituent cell types in vivo.
In contrast to single cell Hi-C data, single-cell DNA methylome datasets enable high-resolution cell-type classification, allowing the reconstruction of epigenomic maps from cell types in primary human tissues 13,14. 3C or HiC methods capture chromatin configuration by performing proximity ligation with restriction digested genomic DNA in crosslinked nuclei 15. DNA methylation (mC) is fully preserved in the chimeric DNA molecules produced by 3C or HiC. Therefore, it is feasible to jointly detect both long-range ligation junction and mC by analyzing DNA molecules generated by 3C or HiC using bisulfite sequencing. Joint analysis of chromatin conformation and mC can also facilitate the study of cross-talk between the two epigenomic features.
Here we describe a method, single-nucleus methyl-3C sequencing (sn-m3C-seq), to jointly profile chromatin conformation and DNA methylation from the same cell. As described in the associated publication, this method allows generates single cell chromatin conformation and DNA methylation profiles that are of equivalent quality as existing unimodal technologies. We have applied these to complex tissue samples such as human prefrontal cortex to generate cell type resolve DNA methylation and 3D genome profiles from the human brain.
Reagents
Reagents
General Reagents
· HyClone™ HyPure™Molecular Biology Grade (MB) Water (GE Life Sci. cat. no. SH30538.03)
· 200-Proof (100%) Ethanol (Koptec cat. no. V1001)
Tissue in situ Hi-C
· Triton-X 100 (Sigma 93443)
· Hoechst (Life Technologies H3570)
· 10X NEB Buffer 4 (NEB B7004S).
· NlaIII restriction enzyme (NEB R0125)
· 10X NEB T4 DNA ligase buffer (NEB B0202)
· 400U/µl T4 DNA Ligase (NEB M0202)
· 2X Protease Inhibitor (Roche 11 873 580 001)
Collection of single nuclei by Fluorescence-activated Cell Sorting (FACS)
· UltraPure™ BSA (50 mg/mL) (ThermoFisher AM2618)
· anti-NeuN AlexaFluor488 (Millipore MAB377X)
· M-Digestion Buffer (Zymo cat. no. D5021-9)
· Proteinase K (Zymo cat. no. D3001-2-D)
· Proteinase K Storage Buffer (Zymo cat. no. D3001-2-B)
· Unmethylated Lambda DNA (Promega cat. no. D1521, 100pg/µL)
Bisulfite conversion
● CT Conversion Reagent (Zymo cat. no. D5003-1)
● M-Solubilization Buffer (Zymo cat. no. D5021-7)
● M-Dilution Buffer-Gold (Zymo cat. no. D5006-2)
● M-Reaction Buffer (Zymo cat. no. D5021-8)
● M-Binding Buffer (Zymo cat. no. D5021-7)
● M-Wash Buffer (Zymo cat. no. D5040-4)
● M-Desulphonation Buffer (Zymo cat. no. D5040-5)
● M-Elution Buffer (Zymo cat. no. D5007-6)
Random primers
● HPLC purified Random primers were ordered from Integrated DNA Technologies (IDT)
P5L_AD002_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCGATGT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD006_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTGCCAAT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD008_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTACTTGA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD010_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTTAGCTT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD001_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTATCACG(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD004_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTTGACCA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD007_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCAGATC(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD012_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCTTGTA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
Sera-Mag Solid Phase Reversible Immobilization (SPRI) beads
● Sera-Mag SpeedBeads Magnetic Carboxylate Modified (GE Healthcare cat. no. 45152105050250)
● Poly(ethylene glycol) PEG 8000 (Sigma cat no. 89510-250G-F)
● TE buffer pH=8.0 (Ambion cat. no. AM9858)
● 5M NaCl
● 1M Tris-HCl pH=8.0
● 0.5M EDTA pH=8.0
● AMPure XP beads (Beckman Coulter cat no. A63881)
● 100 bp DNA ladder (New England Biolabs cat no. N3231L)
snmC-seq2 library preparation
● Blue Buffer (10x) (Enzymatics cat. no. P7010-HC-L)
● Klenow Exo- (50U/µL) (Enzymatics cat. no. P7010-HC-L)
● Deoxynucleotide Solution Mix (10mM each dNTP) (NEB cat. no. N0447L)
● Exonuclease I (20U/µL) (Enzymatics cat. no. X8010L)
● Shrimp Alkaline Phosphatase (rSAP) (1U/µL) (NEB cat. no. M0371L)
● Sera-Mag SPRI beads
● M-Elution Buffer (Zymo cat. no. 5007-6)
● EB buffer (Qiagen cat. no. 19086)
● Accel-NGS® Adaptase™ Module (Swift Bio cat. no. 330384)
● P5 Indexing Primer (IDT custom DNA oligo, standard desalted)
● P7 Indexing Primer (IDT custom DNA oligo, standard desalted)
● KAPA HiFi HS RM (Kapa cat. no. KK2602)
● Qubit dsDNA BR Assay Kit (Thermo Fisher cat. no. Q32850)
Reagent Setup
Ethanol, 80%
To 40mL of 200-proof Ethanol, add 10µL MB water in a 50mL tube. Keep solution sealed when not in use. Prepare ~6 tubes fresh before each library preparation.
Digestion Buffer Plates (for FACS sorting)
In a 50mL tube, combine 15mL M-Digestion Buffer (incubate for 10 minutes at 37°C to dissolve precipitate) with 14mL MB water. Resuspend one tube Proteinase K with 1mL Proteinase K Resuspension Buffer and add 1mL to the digestion buffer mix. Add 10µL λ DNA to aid determination of bisulfite conversion efficiency. Vortex to mix. Aliquot 2µL per well to 20 384-well plates to use for FACS sorting of stained nuclei (TECAN script ). Plates can be stored at 4C.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script -2uL_Digestion_Buffer.
Sera-Mag Solid Phase Reversible Immobilization (SPRI) Beads
Mix Sera-Mag SpeedBeads and transfer 1mL to a 1.5ml tube.
Place SpeedBeads on a magnetic stand until clears and carefully remove the supernatant. Wash the beads twice with 1ml of TE. For each wash, remove the tube from the magnet and mix by inversions. Resuspend the washed beads in 1ml of TE.
Add 9g of PEG 8000 to a new 50ml sterile conical tube.
Add 10ml of 5M NaCl to the 50ml tube.
Add 500µl of 1M Tris-HCl pH=8.0 and 100ul of 0.5M EDTA pH=8.0 to the 50ml tube.
Mix until all dissolves into solution.
Add 1ml of resuspended SpeedBeads to the 50ml tube and fill the volume with MB water.
Test against AMPure XP beads using 100bp DNA ladder.
CT Conversion Reagent
Add 7.9 mL M-Solubilization Buffer and 3 mL M-Dilution Buffer to a bottle of CT Conversion Reagent. Shake vigorously at room temperature to fully dissolve before adding 1.6 mL M-Reaction Buffer.
M-Wash Buffer
Add 288mL 200-proof Ethanol to four bottles of M-Wash buffer. Invert to mix. Make fresh each time. Extra buffer can be stored at room temperature.
Random Primer solution
35µL random primer stock (100µM) in 7mL M-Elution buffer (500nM final primer concentration). Aliquot to eight 96-well plates.
Random Priming Master Mix
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Random Priming Master Mix in a 15mL tube and vortex to mix. Aliquot 180µL of master mix into each well of one 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
Blue Buffer (10x) 1 µL 3600 µL
Klenow exo- (50U/µL)0.25 µL 900 µL
dNTP (10mM each) 0.5 µL 1800 µL
MB water 3.25 µL 11700 µL
Exo/rSAP Master Mix
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Exo/SAP Master Mix in a 15mL tube and vortex to mix. Aliquot 53µL master mix to each well of one 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
Exonuclease 1 (20U/uL) 1 uL 3600 uL
rSAP (1U/uL) 0.5 uL 1800 uL
Adaptase Master Mix (using Accel-NGS® Adaptase™ Module)
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Adaptase Master Mix in a 15mL tube and vortex to mix. Aliquot 48 uL master mix to each well of on 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
EB 4.25 uL 1912.5 uL
Buffer G1 2 uL 900 uL
Reagent G2 2 uL 900 uL
Reagent G3 1.25 uL 562.5 uL
Enzyme G4 0.5 uL 225 uL
Enzyme G5 0.5 uL 225 uL
PCR Primer Mix
Sequences of indexing primers with unique dual barcodes are provided in Supplementary Table 2. Each PCR Primer Mix contains a P5L indexing primer (600 nM) and a P7L indexing primer (1 µM).
Equipment
Equipment
· GenteMACS M-Tube (Miltenyi Biotec 130-096-335)
· 40 µm nylon cell strainer (Corning 431750)
· Mortar and pestle (Fisher S337621)
· Formaldehyde (Fisher F79500)
·
● 384-Well Hardshell PCR Plate Clear, 20 Pcs/pk (Thermo Fisher cat. no. 4483285)
● 96-Well Hardshell PCR Plate GPLE, 20 Pcs/pk (Thermo Fisher cat. no. 4483348)
● Zymo-Spin 384 Well Plate, 2 pack (Zymo cat. no. C2012)
● 2.0mL 96-well Deep Well Polypropylene Plate, Sterilized (USA-SCI. cat. no. 1896-2110)
● Reservoir Single Well 96 Bottom High Profile, Clear (Axygen cat. no. RES-SW96-HP)
● Reservoir Single Well 96 Bottom Low Profile, Clear (Axygen cat. no. RES-SW96-LP)
● 15mL Centrifuge Tubes (Olympus cat. no. 28-103)
● 50mL Centrifuge Tubes (Olympus cat. no. 28-106)
● 1.5µL Eppendorf Tubes (Thermo Fisher cat. no. 02-681-320)
● 300µL 8-Strip Tubes
● Microamp Clear Adhesive Film, 100pc (Thermo Fisher cat. no. 4306311)
● Microporous Film, -20C to 80C, 50p, sterile (USA-SCI. cat. no. 2920-1010)
● Speedball Deluxe Soft Rubber Brayer, 4 inches (Statesville N.C.)
● 37°C Incubator
● 384-well and 96-well Compatible Thermocycler
● DynaMag™-96 Side Magnet (Thermo Fisher cat. no. 12331D)
● DynaMag™-2 Magnet (Thermo Fisher cat. no. 12321D)
● Allegra 25R Centrifuge with S5700 2x96 Swinging Bucket Rotor (Beckman Coulter cat. no. 368954)
○ All centrifuge steps at 5000xg for 5 minutes at room temperature unless otherwise specified
● (Optional) Axygen DITI 50μL STE.FIL. Robotics Tips (Thermo Fisher cat. no. EVF-50-RS)
● (Optional) Axygen DITI 180μL STE.FIL. Robotics Tips (Thermo Fisher cat. no. EVF-180-RS)
● (Optional) TECAN Freedom Evo 100 Base Unit with MultiChannel™ Arm MCA 96
● (Optional/Required for TECAN use) Collection Spacer/Adapter, Type 2, 26.5mm, Te-VacS (Tecan US Inc. cat. no. 10760662)
Procedure
Tissue Fixation
1. Place mortar and pestle, 15 mL conical tube, and a metal spatula in dry ice for 15 minutes. (Do this in a styrofoam box with lid on to prevent condensation).
2. Pulverize the brain sample using the mortar and pestle.
3. Scrape the powdered tissue using a metal spatula into a 15 mL conical tube and resuspend the tissue in 5 mL of PBS.
4. Add 276 µL of 37% formaldehyde and incubate at room temperature for 10 minutes with slow rotation.
5. Add 447 µL of 2.5 M glycine solution to quench the reaction. Incubate at room temperature for 5 minutes with slow rotation.
6. Centrifuge for 10 minutes at 1000 rpm at 4°C. Discard supernatant into an appropriate collection container.
7. Resuspend cells in 1mL of PBS and transfer the sample to 1.75 mL eppendorf tube. Spin for 5 minutes at 1000 rpm at 4°C. Discard supernatant and flash-freeze cell pellets in liquid nitrogen or dry ice.
8. Either proceed to the rest of the protocol or store cell pellets at -80°C.
Lysis and Restriction Digest
Lysis Buffer:
50µL 1M CaCl2
30µl 1M MgAc
40µl 0.5M EDTA
10µl 0.5M EGTA
100 µl 1M Tris-HCl pH 8
400 µl 50X stock protease inhibitors (Roche)
10 µl 1M DTT
10 µl 0.1M/ml PMSF
9.35 mL Water
*Dissolve one tablet - Complete protease inhibitor in 1mL water to get 50X stock.
* Add 400 µl of 10% Triton-X 100 to 8 mL of Lysis buffer to make Lysis buffer with 0.4% Triton-X.
9. Prior to starting the protocol, place a M-tube (Miltenyi Biotec 130-096-335) and a 50 mL conical tube in ice for 15 minutes. Prepare lysis buffer without and with 0.4% Triton-X 100 (Sigma 93443) and place it in ice. (For processing one crosslinked pellet, prepare 5 mL of each of Lysis buffer without and with 0.4% Triton-X 100).
10. Add 1 mL of ice-cold lysis buffer to one crosslinked pellet of cells and resuspend the cells. Transfer the sample to a M-Tube.
11. Add another 2 mL of the lysis buffer to the M-tube. Insert the M-tube to gentleMACS Dissociator and run the gentleMACS factory-set program: “Protein-M-tube-1.0”.
12. Transfer the M-tube to ice. Pour the sample through a 40 µm nylon cell strainer (Corning 431750) over the 50 mL conical tube kept in ice. Add 3 mL of Lysis buffer with 0.4% Triton-X to the M-Tube. Close the M-tube with its cap and invert gently a couple of times to wash the tube and pour it over the cell strainer.
13. Pool both the lysis buffer together (one without Triton-X and the other with 0.4% Triton-X) to make a 0.2% Triton-X solution.
14. Wash the cell strainer with 2 mL of Lysis buffer with 0.2% Triton-X. Discard the cell strainer.
15. Centrifuge the 50 mL conical tube at 1000 rpm for 10 minutes at 4 C. Discard the supernatant carefully. (Remove the supernatant carefully using vacuum. Do not invert the tube to discard the supernatant).
16. Resuspend the pellet in 1 mL of Lysis buffer with 0.2% Triton-X and transfer it to a 1.75 mL Eppendorf tube.
17. Centrifuge at 2500 G for 10 minutes at 4 C. Discard the supernatant.
18. Gently resuspend pellet in 50 µl of 0.5% sodium dodecyl sulfate (SDS) and incubate at 62°C for 10 minutes, shaking.
19. After heating is over, add 145µl of H2O and 25µl of 10% Triton X-100 to quench the SDS. Mix well, avoiding excessive foaming. Incubate at 37°C for 15 minutes, shaking.
20. Add 25µl of 10X NEB Buffer 4 (NEB B7004S). Then add 20 µl (200U) of NlaIII restriction enzyme (NEB R0125) and digest chromatin ON at 37°C, shaking.
Proximity Ligation and Staining
21. Incubate at 62°C (shaking) for 20 minutes to inactivate NlaIII, then cool to room temperature.
22. Add 900µl of ligation master mix to sample
Ligation Buffer:
* 663µl H2O
* 120µl 10X NEB T4 DNA ligase buffer (NEB B0202)
* 100µl 10% Triton X-100
* 12µl 10mg/mL Bovine Serum Albumin
* 5µl 400U/µl T4 DNA Ligase (NEB M0202)
23. Mix by inverting and incubate at room temperature for 4 hours with slow rotation.
24. Add 15 µl of 0.1 µg/µl of Hoechst (Life Technologies H3570) for the last 30 minutes of the ligation step.
25. Spin the sample at 2500 G for 5 minutes and discard the supernatant. Resuspend the pellet in 600 µl of PBS. Add 6 µl of 0.1 µg/µl of Hoechst to the sample.
26. Pass the sample through a 40 µm nylon cell strainer (Corning 431750) into another 1.75 mL eppendorf tube.
27. Centrifuge sample for 5 minutes at 2500g, aspirate supernatant carefully
28. (Optional) If using cellular markers for FACS: Resuspend pellet in 900µL of DPBS + RNase inhibitors
29. (Optional) If using cellular markers for FACS: Add 100µL of UltraPure BSA (50mg/mL)
30. (Optional) If using cellular markers for FACS: Incubate on ice for 20 minutes
31. (Optional) If using cellular markers for FACS: add appropriate antibodies. For example, to enrich for neural populations from human brain samples, we add 1µL of AlexaFluor 488 conjugated anti-NeuN antibody, incubate on ice for 20 minutes.
32. (Optional) If using cellular markers for FACS: Centrifuge sample for 5 minutes at 2500g, aspirate supernatant carefully
33. Reuspsent pellet in 1mL of DPBS + RNase inhibitors
Cell Sorting
34. Prepare 384 well plates for cell sorting as described in “Reagents Setup” of “Reagents” section.
35. Sort cells using FACS into 384 well plates. Nuclei are first gated based on Forward Scatter (FSC) and Side Scatter (SSC) pulse height, then multiplet exclusion gating was applied (forward scatter and side scatter pulse width). Finally, nuclei of specific DNA content were selected (e.g. 2N) by virtue of Hoechst fluorescence intensity.
36. After sorting, plates are incubated at 50?C for 20 minutes in a 384 well PCR block with heated lid for proteinase K digestion.
37. At this point, plates can be sorted at -20?C until ready for further processing.
Bisulfite Conversion
Timing ~ 5h
38. Add 15µL CT conversion reagent to each well of 384-well plate. Pipette up and down for 8 times to mix the sample.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 15uL_Conversion_Buffer
39. Seal the plate with adhesive film and quick spin for 10s at 2,000xg at room temperature. Place the plate in a thermocycler and run the following program:
98°C 8 min
64°C 3.5hrs
4°C Hold
40. Load 80µL M-Binding buffer to each well of 384-Well DNA Binding Plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 80uL_Binding Buffer
41. Transfer bisulfite conversion reactions to Zymo-Spin 384 Well DNA Binding Plate. Pipette up and down for 8 times to mix the sample. Place the 384-Well DNA Binding Plate on a 2.0mL 96-well Deep Well Plate and centrifuge for 5 min at 5,000g. Discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 17uL_Conversion_Rxn_To_Binding_Buffer.
42. Add 100µL M-Wash Buffer to each well of 384-Well DNA Binding Plate. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 100uL_M_Wash_Buffer.
43. Add 50µL M-Desulphonation Buffer to each well of 384-Well DNA Binding Plate. Incubate at room temperature for 15 min. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 50uL_Desulphonation_Buffer.
44. Add 100µL M-Wash Buffer to each well of 384-Well DNA Binding Plate. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 100uL_M_Wash_Buffer.
45. Repeat step 7.
46. Place 384-Well DNA Binding Plate on new 384-well PCR plate. Add 7µL Random Primer Solution. Each quadrant of 384-well plate is barcoded with a distinct indexed random primer (Fig. 2). Every two 384-well plates receive a complete set of all eight indexed random primers. Incubate for 5 min at room temperature. Centrifuge for 5 min at 5,000g and discard the 384-Well DNA Binding Plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 7uL_Primer_Elution.
47. Seal the plate with adhesive film and store at -20°C for up to 1 week.
Random-primed DNA synthesis
Timing ~2h
48. Denature the samples by placing 384-well PCR plate on a thermocycler and run the following program.
95°C 3 min
Immediately place the plate on ice for 2 minutes.
49. Add 5µL Random Priming Master Mix to each well of the 384-well PCR plate. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 5uL Random_Priming_Mix.
50. Place the plate in a thermocycler and run the following program:
4°C 5 min
25°C 5 min
37°C 60 min
4°C Hold
Inactivation of free primers & dNTP
51. Add 1.5µL Exo/rSAP Master Mix to each well of the 384-well PCR plate. Vortex to mix the samples and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 1uL_Exo_rSAP_MM.
52. Place the plate in a thermocycler and run the following program
37°C 30 min
4°C Hold
Sample clean-up
53. Add 73.6µL (0.8x) SPRI Beads to each well of four clean 96-well PCR plates.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_To_Clean_96well.
54. Transfer samples from two 384-well plates to each 96-well plate. The eight quadrants (from two 384-well plates) barcoded with distinct indexed random primers are combined. Mix the samples by vortexing and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Transfer_Lib_384well_To_96well.
55. Place 96-well plates on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 3x with 150µL fresh 80% EtOH. Remove all EtOH, remove plates from magnet, and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_2Plate_150uL_EtOH_Wash.
56. Add 10µL EB buffer and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes).
57. Remove 10uL supernatant to a clean 96-well PCR plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_96Well_Elution.
Adaptase reaction
58. Denature the samples by placing 96-well plates on a thermocycler and run the following program.
95°C 3 min
Immediately place the plate on ice for 2 minutes.
59. Add 10.5µL Adaptase Master Mix to each well of the 96-well PCR plate. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_25uL_Adaptase_KAPA. Enter 10.5uL for the volume transferred.
60. Place the plate in a thermocycler and run the following program:
37°C 30 min
95°C 2 min
4°C Hold
Library amplification
61. Add 5uL PCR Primer Mix.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 5uL_PCR_Primer.
62. Add 25µL 2x KAPA HiFi Mix. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_25uL_Adaptase_KAPA. Enter 25uL for the volume transferred.
63. Place the plate in a thermocycler and run the following program:
a. 95°C 2 min
b. 98°C 30s
c. 98°C 15s
d. 64°C 30s
e. 72°C 2 min
Go to step c 14 times
f. 72°C 5 min
g. 4°C Hold
Library clean-up
64. Sample cleanup. Add 40µL (0.8x) SPRI Beads to each well of four 96-well PCR plates. Transfer contents of one 96-well plate to another to combine four 96-well plates to two 96-well plates. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_Beads_And_Combine_96well.
65. Place 96-well plates on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 150µL fresh 80% EtOH. Remove all EtOH, remove plate from magnet and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_2Plate_150uL_EtOH_Wash (stop script after two wash steps).
66. Add 25µL EB and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes). Remove 25uL supernatant to a clean 96-well PCR plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 20uL_96Well_Elution.
67. Add 20µL (0.8x) SPRI Beads to each well of two 96-well PCR plates. Transfer contents of one 96-well plate to another to combine two 96-well plates to one 96-well plate. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_Beads_And_Combine_96well.
68. Place 96-well plate on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 150µL fresh 80% EtOH. Remove all EtOH, remove plate from magnet, and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_1Plate_150uL_EtOH_Wash.
69. Add 20µL EB buffer and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes). Combine 20µL eluent from all wells in each column of the 96-well plate (8 wells per column, 12 columns) into 12 1.5µL Eppendorf tubes.
70. Add 128µL (0.8x) SPRI Beads to each 1.5µL Eppendorf tube. Pipette to mix and incubate for 5 minutes at room temperature.
71. Place 1.5µL tubes on DynaMag™-2 Magnet, let stand until solution in tubes in clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 200uL fresh 80% EtOH. Remove all EtOH, remove tubes from magnet, and let beads dry at room temperature. DO NOT overdry beads.
72. Add 40µL EB and resuspend beads by pipet. Incubate for 5 minutes at room temperature. Place tubes back on magnet and let stand until solution is clear of beads (~5 minutes). Remove 40uL supernatant to 12 clean 1.5µL Eppendorf tubes.
73. Measure concentration of each 1.5µL Eppendorf tube with Qubit dsDNA BR Assay Kit. Normalize library concentrations and pool for sequencing.
References
1. Dixon, J. R., Gorkin, D. U. & Ren, B. Chromatin Domains: The Unit of Chromosome Organization. Mol. Cell 62, 668–680 (2016).
2. Rowley, M. J. & Corces, V. G. The three-dimensional genome: principles and roles of long-distance interactions. Curr. Opin. Cell Biol. 40, 8–14 (2016).
3. Dekker, J. & Heard, E. Structural and functional diversity of Topologically Associating Domains. FEBS Lett. 589, 2877–2884 (2015).
4. Dixon, J. R. et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485, 376–380 (2012).
5. Dixon, J. R. et al. Chromatin architecture reorganization during stem cell differentiation. Nature 518, 331–336 (2015).
6. Rao, S. S. P. et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159, 1665–1680 (2014).
7. Bonev, B. et al. Multiscale 3D Genome Rewiring during Mouse Neural Development. Cell 171, 557–572.e24 (2017).
8. Schmitt, A. D. et al. A Compendium of Chromatin Contact Maps Reveals Spatially Active Regions in the Human Genome. Cell Rep. 17, 2042–2059 (2016).
9. Cusanovich, D. A. et al. A Single-Cell Atlas of In Vivo Mammalian Chromatin Accessibility. Cell 174, 1309–1324.e18 (2018).
10. Lake, B. B. et al. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain. Science 352, 1586–1590 (2016).
11. Klein, A. M. et al. Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells. Cell 161, 1187–1201 (2015).
12. Macosko, E. Z. et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell 161, 1202–1214 (2015).
13. Luo, C. et al. Single-cell methylomes identify neuronal subtypes and regulatory elements in mammalian cortex. Science 357, 600–604 (2017).
14. Hui, T. et al. High-Resolution Single-Cell DNA Methylation Measurements Reveal Epigenetically Distinct Hematopoietic Stem Cell Subpopulations. Stem Cell Reports 11, 578–592 (2018).
15. Sajan, S. A. & Hawkins, R. D. Methods for identifying higher-order chromatin structure. Annu. Rev. Genomics Hum. Genet. 13, 59–82 (2012).
Version History
CURRENT STATUS: posted
Version 1
Posted 09 Sep, 2019
Metrics
Comments: 0
HTML Views: ...
Subject Areas
Molecular Biology
Biotechnology
Computational biology and bioinformatics
Genetics
Cell biology
Associated Publications
More from Protocol Exchange
Brain and blood extraction for immunostaining, protein, and RNA measurements after long-term two photon imaging in mice.
In vitro transcription and micro-injection of Kdm4a mRNA into mouse oocytes
Establishment of a RESEARCH USE ONLY Condensed-Efficient-Fast (CEF) PITX2 workflow for analysis of PITX2 DNA methylation in small tumor tissue samples
Detection of endogenous and drug-modulated CYP3A activity in cells using LC-MS/MS
Recovery of Paired T Cell Receptors from Single-cell Seq-Well Libraries
CUTseq is a versatile method for preparing multiplexed DNA sequencing libraries from low-input samples
Method Article
Single-cell multi-omic profiling of chromatin conformation and DNA methylation
Jesse R Dixon
Salk Institute for Biological Studies
Corresponding Author
ORCiD: https://orcid.org/0000-0002-6273-2181
Joseph R Ecker
Salk Institute for Biological Studies
Corresponding Author
ORCiD: https://orcid.org/0000-0001-5799-5895
Article
Peer Review Timeline
Metrics
Related Articles
Comments
Abstract
The ability to profile epigenomic features in single cells is facilitating the study of the variation in transcription regulation at the single cell level. Single cell methods have also facilitated the generation of cell-type resolved transcriptomic and epigenetic profiles of lineages derived from complex heterogeneous samples. However, integrating different epigenetic features remain challenging, as many current methods profile a single data type at at time. Furthermore, some epigenetic features, such as 3D genome organization, are intrinsically variable between single cells of the same lineage, so it remains unclear how well these methods may resolve cell-types from complex mixtures. Here we describe a method for profiling 3D genome organization and DNA methylation in single cells. This protocol accompanies Lee et al. (Nature Methods 2019) after peer review to aid potential users in applying the method to their own samples.
Figures
Figure 1
Figure 2
Introduction
Three-dimensional genome architecture is a critical feature of gene regulation in metazoan organisms 1–3. Despite the increasing utility of these datasets, most existing chromatin conformation maps are generated from cell lines in vitro or from bulk tissues in vivo 4–8. While cell line data has enabled a greater understanding of the general principles of chromatin organization, it cannot fully represent the diversity of cell types that arise in vivo. Recent efforts using single-cell “omics” technologies aims to resolve this challenge by generating single-cell data from complex tissues that are then partitioned into the relevant distinct cell types in silico using data dimensionality reduction and clustering algorithms 9–12. However, it remains unclear whether single-cell Hi-C profiles will be suitable for partitioning into constituent cell types in vivo.
In contrast to single cell Hi-C data, single-cell DNA methylome datasets enable high-resolution cell-type classification, allowing the reconstruction of epigenomic maps from cell types in primary human tissues 13,14. 3C or HiC methods capture chromatin configuration by performing proximity ligation with restriction digested genomic DNA in crosslinked nuclei 15. DNA methylation (mC) is fully preserved in the chimeric DNA molecules produced by 3C or HiC. Therefore, it is feasible to jointly detect both long-range ligation junction and mC by analyzing DNA molecules generated by 3C or HiC using bisulfite sequencing. Joint analysis of chromatin conformation and mC can also facilitate the study of cross-talk between the two epigenomic features.
Here we describe a method, single-nucleus methyl-3C sequencing (sn-m3C-seq), to jointly profile chromatin conformation and DNA methylation from the same cell. As described in the associated publication, this method allows generates single cell chromatin conformation and DNA methylation profiles that are of equivalent quality as existing unimodal technologies. We have applied these to complex tissue samples such as human prefrontal cortex to generate cell type resolve DNA methylation and 3D genome profiles from the human brain.
Reagents
Reagents
General Reagents
· HyClone™ HyPure™Molecular Biology Grade (MB) Water (GE Life Sci. cat. no. SH30538.03)
· 200-Proof (100%) Ethanol (Koptec cat. no. V1001)
Tissue in situ Hi-C
· Triton-X 100 (Sigma 93443)
· Hoechst (Life Technologies H3570)
· 10X NEB Buffer 4 (NEB B7004S).
· NlaIII restriction enzyme (NEB R0125)
· 10X NEB T4 DNA ligase buffer (NEB B0202)
· 400U/µl T4 DNA Ligase (NEB M0202)
· 2X Protease Inhibitor (Roche 11 873 580 001)
Collection of single nuclei by Fluorescence-activated Cell Sorting (FACS)
· UltraPure™ BSA (50 mg/mL) (ThermoFisher AM2618)
· anti-NeuN AlexaFluor488 (Millipore MAB377X)
· M-Digestion Buffer (Zymo cat. no. D5021-9)
· Proteinase K (Zymo cat. no. D3001-2-D)
· Proteinase K Storage Buffer (Zymo cat. no. D3001-2-B)
· Unmethylated Lambda DNA (Promega cat. no. D1521, 100pg/µL)
Bisulfite conversion
● CT Conversion Reagent (Zymo cat. no. D5003-1)
● M-Solubilization Buffer (Zymo cat. no. D5021-7)
● M-Dilution Buffer-Gold (Zymo cat. no. D5006-2)
● M-Reaction Buffer (Zymo cat. no. D5021-8)
● M-Binding Buffer (Zymo cat. no. D5021-7)
● M-Wash Buffer (Zymo cat. no. D5040-4)
● M-Desulphonation Buffer (Zymo cat. no. D5040-5)
● M-Elution Buffer (Zymo cat. no. D5007-6)
Random primers
● HPLC purified Random primers were ordered from Integrated DNA Technologies (IDT)
P5L_AD002_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCGATGT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD006_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTGCCAAT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD008_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTACTTGA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD010_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTTAGCTT(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD001_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTATCACG(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD004_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTTGACCA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD007_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCAGATC(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
P5L_AD012_H /5SpC3/TTCCCTACACGACGCTCTTCCGATCTCTTGTA(H1:33340033)(H1)(H1)(H1)(H1)(H1)(H1)(H1)(H1)
Sera-Mag Solid Phase Reversible Immobilization (SPRI) beads
● Sera-Mag SpeedBeads Magnetic Carboxylate Modified (GE Healthcare cat. no. 45152105050250)
● Poly(ethylene glycol) PEG 8000 (Sigma cat no. 89510-250G-F)
● TE buffer pH=8.0 (Ambion cat. no. AM9858)
● 5M NaCl
● 1M Tris-HCl pH=8.0
● 0.5M EDTA pH=8.0
● AMPure XP beads (Beckman Coulter cat no. A63881)
● 100 bp DNA ladder (New England Biolabs cat no. N3231L)
snmC-seq2 library preparation
● Blue Buffer (10x) (Enzymatics cat. no. P7010-HC-L)
● Klenow Exo- (50U/µL) (Enzymatics cat. no. P7010-HC-L)
● Deoxynucleotide Solution Mix (10mM each dNTP) (NEB cat. no. N0447L)
● Exonuclease I (20U/µL) (Enzymatics cat. no. X8010L)
● Shrimp Alkaline Phosphatase (rSAP) (1U/µL) (NEB cat. no. M0371L)
● Sera-Mag SPRI beads
● M-Elution Buffer (Zymo cat. no. 5007-6)
● EB buffer (Qiagen cat. no. 19086)
● Accel-NGS® Adaptase™ Module (Swift Bio cat. no. 330384)
● P5 Indexing Primer (IDT custom DNA oligo, standard desalted)
● P7 Indexing Primer (IDT custom DNA oligo, standard desalted)
● KAPA HiFi HS RM (Kapa cat. no. KK2602)
● Qubit dsDNA BR Assay Kit (Thermo Fisher cat. no. Q32850)
Reagent Setup
Ethanol, 80%
To 40mL of 200-proof Ethanol, add 10µL MB water in a 50mL tube. Keep solution sealed when not in use. Prepare ~6 tubes fresh before each library preparation.
Digestion Buffer Plates (for FACS sorting)
In a 50mL tube, combine 15mL M-Digestion Buffer (incubate for 10 minutes at 37°C to dissolve precipitate) with 14mL MB water. Resuspend one tube Proteinase K with 1mL Proteinase K Resuspension Buffer and add 1mL to the digestion buffer mix. Add 10µL λ DNA to aid determination of bisulfite conversion efficiency. Vortex to mix. Aliquot 2µL per well to 20 384-well plates to use for FACS sorting of stained nuclei (TECAN script ). Plates can be stored at 4C.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script -2uL_Digestion_Buffer.
Sera-Mag Solid Phase Reversible Immobilization (SPRI) Beads
Mix Sera-Mag SpeedBeads and transfer 1mL to a 1.5ml tube.
Place SpeedBeads on a magnetic stand until clears and carefully remove the supernatant. Wash the beads twice with 1ml of TE. For each wash, remove the tube from the magnet and mix by inversions. Resuspend the washed beads in 1ml of TE.
Add 9g of PEG 8000 to a new 50ml sterile conical tube.
Add 10ml of 5M NaCl to the 50ml tube.
Add 500µl of 1M Tris-HCl pH=8.0 and 100ul of 0.5M EDTA pH=8.0 to the 50ml tube.
Mix until all dissolves into solution.
Add 1ml of resuspended SpeedBeads to the 50ml tube and fill the volume with MB water.
Test against AMPure XP beads using 100bp DNA ladder.
CT Conversion Reagent
Add 7.9 mL M-Solubilization Buffer and 3 mL M-Dilution Buffer to a bottle of CT Conversion Reagent. Shake vigorously at room temperature to fully dissolve before adding 1.6 mL M-Reaction Buffer.
M-Wash Buffer
Add 288mL 200-proof Ethanol to four bottles of M-Wash buffer. Invert to mix. Make fresh each time. Extra buffer can be stored at room temperature.
Random Primer solution
35µL random primer stock (100µM) in 7mL M-Elution buffer (500nM final primer concentration). Aliquot to eight 96-well plates.
Random Priming Master Mix
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Random Priming Master Mix in a 15mL tube and vortex to mix. Aliquot 180µL of master mix into each well of one 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
Blue Buffer (10x) 1 µL 3600 µL
Klenow exo- (50U/µL)0.25 µL 900 µL
dNTP (10mM each) 0.5 µL 1800 µL
MB water 3.25 µL 11700 µL
Exo/rSAP Master Mix
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Exo/SAP Master Mix in a 15mL tube and vortex to mix. Aliquot 53µL master mix to each well of one 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
Exonuclease 1 (20U/uL) 1 uL 3600 uL
rSAP (1U/uL) 0.5 uL 1800 uL
Adaptase Master Mix (using Accel-NGS® Adaptase™ Module)
To have sufficient reagents for robotic preparation of 3,072 reactions, prepare 3600 reactions of Adaptase Master Mix in a 15mL tube and vortex to mix. Aliquot 48 uL master mix to each well of on 96-well plate. Keep sealed on ice until use. Do not store.
Reagent Vol. per reaction Vol. for 3,600 reactions
EB 4.25 uL 1912.5 uL
Buffer G1 2 uL 900 uL
Reagent G2 2 uL 900 uL
Reagent G3 1.25 uL 562.5 uL
Enzyme G4 0.5 uL 225 uL
Enzyme G5 0.5 uL 225 uL
PCR Primer Mix
Sequences of indexing primers with unique dual barcodes are provided in Supplementary Table 2. Each PCR Primer Mix contains a P5L indexing primer (600 nM) and a P7L indexing primer (1 µM).
Equipment
Equipment
· GenteMACS M-Tube (Miltenyi Biotec 130-096-335)
· 40 µm nylon cell strainer (Corning 431750)
· Mortar and pestle (Fisher S337621)
· Formaldehyde (Fisher F79500)
·
● 384-Well Hardshell PCR Plate Clear, 20 Pcs/pk (Thermo Fisher cat. no. 4483285)
● 96-Well Hardshell PCR Plate GPLE, 20 Pcs/pk (Thermo Fisher cat. no. 4483348)
● Zymo-Spin 384 Well Plate, 2 pack (Zymo cat. no. C2012)
● 2.0mL 96-well Deep Well Polypropylene Plate, Sterilized (USA-SCI. cat. no. 1896-2110)
● Reservoir Single Well 96 Bottom High Profile, Clear (Axygen cat. no. RES-SW96-HP)
● Reservoir Single Well 96 Bottom Low Profile, Clear (Axygen cat. no. RES-SW96-LP)
● 15mL Centrifuge Tubes (Olympus cat. no. 28-103)
● 50mL Centrifuge Tubes (Olympus cat. no. 28-106)
● 1.5µL Eppendorf Tubes (Thermo Fisher cat. no. 02-681-320)
● 300µL 8-Strip Tubes
● Microamp Clear Adhesive Film, 100pc (Thermo Fisher cat. no. 4306311)
● Microporous Film, -20C to 80C, 50p, sterile (USA-SCI. cat. no. 2920-1010)
● Speedball Deluxe Soft Rubber Brayer, 4 inches (Statesville N.C.)
● 37°C Incubator
● 384-well and 96-well Compatible Thermocycler
● DynaMag™-96 Side Magnet (Thermo Fisher cat. no. 12331D)
● DynaMag™-2 Magnet (Thermo Fisher cat. no. 12321D)
● Allegra 25R Centrifuge with S5700 2x96 Swinging Bucket Rotor (Beckman Coulter cat. no. 368954)
○ All centrifuge steps at 5000xg for 5 minutes at room temperature unless otherwise specified
● (Optional) Axygen DITI 50μL STE.FIL. Robotics Tips (Thermo Fisher cat. no. EVF-50-RS)
● (Optional) Axygen DITI 180μL STE.FIL. Robotics Tips (Thermo Fisher cat. no. EVF-180-RS)
● (Optional) TECAN Freedom Evo 100 Base Unit with MultiChannel™ Arm MCA 96
● (Optional/Required for TECAN use) Collection Spacer/Adapter, Type 2, 26.5mm, Te-VacS (Tecan US Inc. cat. no. 10760662)
Procedure
Tissue Fixation
1. Place mortar and pestle, 15 mL conical tube, and a metal spatula in dry ice for 15 minutes. (Do this in a styrofoam box with lid on to prevent condensation).
2. Pulverize the brain sample using the mortar and pestle.
3. Scrape the powdered tissue using a metal spatula into a 15 mL conical tube and resuspend the tissue in 5 mL of PBS.
4. Add 276 µL of 37% formaldehyde and incubate at room temperature for 10 minutes with slow rotation.
5. Add 447 µL of 2.5 M glycine solution to quench the reaction. Incubate at room temperature for 5 minutes with slow rotation.
6. Centrifuge for 10 minutes at 1000 rpm at 4°C. Discard supernatant into an appropriate collection container.
7. Resuspend cells in 1mL of PBS and transfer the sample to 1.75 mL eppendorf tube. Spin for 5 minutes at 1000 rpm at 4°C. Discard supernatant and flash-freeze cell pellets in liquid nitrogen or dry ice.
8. Either proceed to the rest of the protocol or store cell pellets at -80°C.
Lysis and Restriction Digest
Lysis Buffer:
50µL 1M CaCl2
30µl 1M MgAc
40µl 0.5M EDTA
10µl 0.5M EGTA
100 µl 1M Tris-HCl pH 8
400 µl 50X stock protease inhibitors (Roche)
10 µl 1M DTT
10 µl 0.1M/ml PMSF
9.35 mL Water
*Dissolve one tablet - Complete protease inhibitor in 1mL water to get 50X stock.
* Add 400 µl of 10% Triton-X 100 to 8 mL of Lysis buffer to make Lysis buffer with 0.4% Triton-X.
9. Prior to starting the protocol, place a M-tube (Miltenyi Biotec 130-096-335) and a 50 mL conical tube in ice for 15 minutes. Prepare lysis buffer without and with 0.4% Triton-X 100 (Sigma 93443) and place it in ice. (For processing one crosslinked pellet, prepare 5 mL of each of Lysis buffer without and with 0.4% Triton-X 100).
10. Add 1 mL of ice-cold lysis buffer to one crosslinked pellet of cells and resuspend the cells. Transfer the sample to a M-Tube.
11. Add another 2 mL of the lysis buffer to the M-tube. Insert the M-tube to gentleMACS Dissociator and run the gentleMACS factory-set program: “Protein-M-tube-1.0”.
12. Transfer the M-tube to ice. Pour the sample through a 40 µm nylon cell strainer (Corning 431750) over the 50 mL conical tube kept in ice. Add 3 mL of Lysis buffer with 0.4% Triton-X to the M-Tube. Close the M-tube with its cap and invert gently a couple of times to wash the tube and pour it over the cell strainer.
13. Pool both the lysis buffer together (one without Triton-X and the other with 0.4% Triton-X) to make a 0.2% Triton-X solution.
14. Wash the cell strainer with 2 mL of Lysis buffer with 0.2% Triton-X. Discard the cell strainer.
15. Centrifuge the 50 mL conical tube at 1000 rpm for 10 minutes at 4 C. Discard the supernatant carefully. (Remove the supernatant carefully using vacuum. Do not invert the tube to discard the supernatant).
16. Resuspend the pellet in 1 mL of Lysis buffer with 0.2% Triton-X and transfer it to a 1.75 mL Eppendorf tube.
17. Centrifuge at 2500 G for 10 minutes at 4 C. Discard the supernatant.
18. Gently resuspend pellet in 50 µl of 0.5% sodium dodecyl sulfate (SDS) and incubate at 62°C for 10 minutes, shaking.
19. After heating is over, add 145µl of H2O and 25µl of 10% Triton X-100 to quench the SDS. Mix well, avoiding excessive foaming. Incubate at 37°C for 15 minutes, shaking.
20. Add 25µl of 10X NEB Buffer 4 (NEB B7004S). Then add 20 µl (200U) of NlaIII restriction enzyme (NEB R0125) and digest chromatin ON at 37°C, shaking.
Proximity Ligation and Staining
21. Incubate at 62°C (shaking) for 20 minutes to inactivate NlaIII, then cool to room temperature.
22. Add 900µl of ligation master mix to sample
Ligation Buffer:
* 663µl H2O
* 120µl 10X NEB T4 DNA ligase buffer (NEB B0202)
* 100µl 10% Triton X-100
* 12µl 10mg/mL Bovine Serum Albumin
* 5µl 400U/µl T4 DNA Ligase (NEB M0202)
23. Mix by inverting and incubate at room temperature for 4 hours with slow rotation.
24. Add 15 µl of 0.1 µg/µl of Hoechst (Life Technologies H3570) for the last 30 minutes of the ligation step.
25. Spin the sample at 2500 G for 5 minutes and discard the supernatant. Resuspend the pellet in 600 µl of PBS. Add 6 µl of 0.1 µg/µl of Hoechst to the sample.
26. Pass the sample through a 40 µm nylon cell strainer (Corning 431750) into another 1.75 mL eppendorf tube.
27. Centrifuge sample for 5 minutes at 2500g, aspirate supernatant carefully
28. (Optional) If using cellular markers for FACS: Resuspend pellet in 900µL of DPBS + RNase inhibitors
29. (Optional) If using cellular markers for FACS: Add 100µL of UltraPure BSA (50mg/mL)
30. (Optional) If using cellular markers for FACS: Incubate on ice for 20 minutes
31. (Optional) If using cellular markers for FACS: add appropriate antibodies. For example, to enrich for neural populations from human brain samples, we add 1µL of AlexaFluor 488 conjugated anti-NeuN antibody, incubate on ice for 20 minutes.
32. (Optional) If using cellular markers for FACS: Centrifuge sample for 5 minutes at 2500g, aspirate supernatant carefully
33. Reuspsent pellet in 1mL of DPBS + RNase inhibitors
Cell Sorting
34. Prepare 384 well plates for cell sorting as described in “Reagents Setup” of “Reagents” section.
35. Sort cells using FACS into 384 well plates. Nuclei are first gated based on Forward Scatter (FSC) and Side Scatter (SSC) pulse height, then multiplet exclusion gating was applied (forward scatter and side scatter pulse width). Finally, nuclei of specific DNA content were selected (e.g. 2N) by virtue of Hoechst fluorescence intensity.
36. After sorting, plates are incubated at 50?C for 20 minutes in a 384 well PCR block with heated lid for proteinase K digestion.
37. At this point, plates can be sorted at -20?C until ready for further processing.
Bisulfite Conversion
Timing ~ 5h
38. Add 15µL CT conversion reagent to each well of 384-well plate. Pipette up and down for 8 times to mix the sample.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 15uL_Conversion_Buffer
39. Seal the plate with adhesive film and quick spin for 10s at 2,000xg at room temperature. Place the plate in a thermocycler and run the following program:
98°C 8 min
64°C 3.5hrs
4°C Hold
40. Load 80µL M-Binding buffer to each well of 384-Well DNA Binding Plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 80uL_Binding Buffer
41. Transfer bisulfite conversion reactions to Zymo-Spin 384 Well DNA Binding Plate. Pipette up and down for 8 times to mix the sample. Place the 384-Well DNA Binding Plate on a 2.0mL 96-well Deep Well Plate and centrifuge for 5 min at 5,000g. Discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 17uL_Conversion_Rxn_To_Binding_Buffer.
42. Add 100µL M-Wash Buffer to each well of 384-Well DNA Binding Plate. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 100uL_M_Wash_Buffer.
43. Add 50µL M-Desulphonation Buffer to each well of 384-Well DNA Binding Plate. Incubate at room temperature for 15 min. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 50uL_Desulphonation_Buffer.
44. Add 100µL M-Wash Buffer to each well of 384-Well DNA Binding Plate. Centrifuge for 5 min at 5,000g and discard the flow through by decanting.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 100uL_M_Wash_Buffer.
45. Repeat step 7.
46. Place 384-Well DNA Binding Plate on new 384-well PCR plate. Add 7µL Random Primer Solution. Each quadrant of 384-well plate is barcoded with a distinct indexed random primer (Fig. 2). Every two 384-well plates receive a complete set of all eight indexed random primers. Incubate for 5 min at room temperature. Centrifuge for 5 min at 5,000g and discard the 384-Well DNA Binding Plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 7uL_Primer_Elution.
47. Seal the plate with adhesive film and store at -20°C for up to 1 week.
Random-primed DNA synthesis
Timing ~2h
48. Denature the samples by placing 384-well PCR plate on a thermocycler and run the following program.
95°C 3 min
Immediately place the plate on ice for 2 minutes.
49. Add 5µL Random Priming Master Mix to each well of the 384-well PCR plate. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 5uL Random_Priming_Mix.
50. Place the plate in a thermocycler and run the following program:
4°C 5 min
25°C 5 min
37°C 60 min
4°C Hold
Inactivation of free primers & dNTP
51. Add 1.5µL Exo/rSAP Master Mix to each well of the 384-well PCR plate. Vortex to mix the samples and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 1uL_Exo_rSAP_MM.
52. Place the plate in a thermocycler and run the following program
37°C 30 min
4°C Hold
Sample clean-up
53. Add 73.6µL (0.8x) SPRI Beads to each well of four clean 96-well PCR plates.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_To_Clean_96well.
54. Transfer samples from two 384-well plates to each 96-well plate. The eight quadrants (from two 384-well plates) barcoded with distinct indexed random primers are combined. Mix the samples by vortexing and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Transfer_Lib_384well_To_96well.
55. Place 96-well plates on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 3x with 150µL fresh 80% EtOH. Remove all EtOH, remove plates from magnet, and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_2Plate_150uL_EtOH_Wash.
56. Add 10µL EB buffer and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes).
57. Remove 10uL supernatant to a clean 96-well PCR plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_96Well_Elution.
Adaptase reaction
58. Denature the samples by placing 96-well plates on a thermocycler and run the following program.
95°C 3 min
Immediately place the plate on ice for 2 minutes.
59. Add 10.5µL Adaptase Master Mix to each well of the 96-well PCR plate. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_25uL_Adaptase_KAPA. Enter 10.5uL for the volume transferred.
60. Place the plate in a thermocycler and run the following program:
37°C 30 min
95°C 2 min
4°C Hold
Library amplification
61. Add 5uL PCR Primer Mix.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 5uL_PCR_Primer.
62. Add 25µL 2x KAPA HiFi Mix. Vortex and quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 10uL_25uL_Adaptase_KAPA. Enter 25uL for the volume transferred.
63. Place the plate in a thermocycler and run the following program:
a. 95°C 2 min
b. 98°C 30s
c. 98°C 15s
d. 64°C 30s
e. 72°C 2 min
Go to step c 14 times
f. 72°C 5 min
g. 4°C Hold
Library clean-up
64. Sample cleanup. Add 40µL (0.8x) SPRI Beads to each well of four 96-well PCR plates. Transfer contents of one 96-well plate to another to combine four 96-well plates to two 96-well plates. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_Beads_And_Combine_96well.
65. Place 96-well plates on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 150µL fresh 80% EtOH. Remove all EtOH, remove plate from magnet and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_2Plate_150uL_EtOH_Wash (stop script after two wash steps).
66. Add 25µL EB and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes). Remove 25uL supernatant to a clean 96-well PCR plate.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - 20uL_96Well_Elution.
67. Add 20µL (0.8x) SPRI Beads to each well of two 96-well PCR plates. Transfer contents of one 96-well plate to another to combine two 96-well plates to one 96-well plate. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_Add_Beads_And_Combine_96well.
68. Place 96-well plate on DynaMag™-96 Side Magnet, let stand until solution in wells is clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 150µL fresh 80% EtOH. Remove all EtOH, remove plate from magnet, and let beads dry at room temperature. DO NOT overdry beads.
(Optional) This step can be automated using TECAN Freedom Evo 100 with script - BP_1Plate_150uL_EtOH_Wash.
69. Add 20µL EB buffer and resuspend beads by pipet. Vortex and incubate for 5 minutes at room temperature, then quick spin for 10s at 2,000xg. Place back on magnet and let stand until solution is clear of beads (~5 minutes). Combine 20µL eluent from all wells in each column of the 96-well plate (8 wells per column, 12 columns) into 12 1.5µL Eppendorf tubes.
70. Add 128µL (0.8x) SPRI Beads to each 1.5µL Eppendorf tube. Pipette to mix and incubate for 5 minutes at room temperature.
71. Place 1.5µL tubes on DynaMag™-2 Magnet, let stand until solution in tubes in clear of beads (~5 minutes). Remove supernatant and wash beads 2x with 200uL fresh 80% EtOH. Remove all EtOH, remove tubes from magnet, and let beads dry at room temperature. DO NOT overdry beads.
72. Add 40µL EB and resuspend beads by pipet. Incubate for 5 minutes at room temperature. Place tubes back on magnet and let stand until solution is clear of beads (~5 minutes). Remove 40uL supernatant to 12 clean 1.5µL Eppendorf tubes.
73. Measure concentration of each 1.5µL Eppendorf tube with Qubit dsDNA BR Assay Kit. Normalize library concentrations and pool for sequencing.
References
1. Dixon, J. R., Gorkin, D. U. & Ren, B. Chromatin Domains: The Unit of Chromosome Organization. Mol. Cell 62, 668–680 (2016).
2. Rowley, M. J. & Corces, V. G. The three-dimensional genome: principles and roles of long-distance interactions. Curr. Opin. Cell Biol. 40, 8–14 (2016).
3. Dekker, J. & Heard, E. Structural and functional diversity of Topologically Associating Domains. FEBS Lett. 589, 2877–2884 (2015).
4. Dixon, J. R. et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485, 376–380 (2012).
5. Dixon, J. R. et al. Chromatin architecture reorganization during stem cell differentiation. Nature 518, 331–336 (2015).
6. Rao, S. S. P. et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159, 1665–1680 (2014).
7. Bonev, B. et al. Multiscale 3D Genome Rewiring during Mouse Neural Development. Cell 171, 557–572.e24 (2017).
8. Schmitt, A. D. et al. A Compendium of Chromatin Contact Maps Reveals Spatially Active Regions in the Human Genome. Cell Rep. 17, 2042–2059 (2016).
9. Cusanovich, D. A. et al. A Single-Cell Atlas of In Vivo Mammalian Chromatin Accessibility. Cell 174, 1309–1324.e18 (2018).
10. Lake, B. B. et al. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain. Science 352, 1586–1590 (2016).
11. Klein, A. M. et al. Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells. Cell 161, 1187–1201 (2015).
12. Macosko, E. Z. et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell 161, 1202–1214 (2015).
13. Luo, C. et al. Single-cell methylomes identify neuronal subtypes and regulatory elements in mammalian cortex. Science 357, 600–604 (2017).
14. Hui, T. et al. High-Resolution Single-Cell DNA Methylation Measurements Reveal Epigenetically Distinct Hematopoietic Stem Cell Subpopulations. Stem Cell Reports 11, 578–592 (2018).
15. Sajan, S. A. & Hawkins, R. D. Methods for identifying higher-order chromatin structure. Annu. Rev. Genomics Hum. Genet. 13, 59–82 (2012).
Comments (0)