A step by step protocol for stabilizing specific DNA G-quadruplexes by CRISPR guided G-quadruplex binding proteins and ligands

doi:10.21203/rs.3.pex-2648/v1

Method Article

A step by step protocol for stabilizing specific DNA G-quadruplexes by CRISPR guided G-quadruplex binding proteins and ligands

https://doi.org/10.21203/rs.3.pex-2648/v1

This work is licensed under a CC BY 4.0 License

This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.

Version 1

posted

You are reading this latest protocol version

Despite the importance of DNA G-quadruplexes (G4s) in health and disease being demonstrated, technologies to readily manipulate specific G4 folding for functional analysis and therapeutic purposes are lacking. Here, we employ the G4-stabilizing protein/ligand in conjunction with CRISPR system to selectively facilitate single or multiple targeted G4 folding within specific genomic loci. We demonstrate that fusion of nucleolin with a catalytically inactive Cas9 (dCas9) can specifically stabilize G4s in the promoter of oncogene MYC and muscle associated gene Itga7 as well as telomere G4s, leading to cell proliferation arrest, inhibition of myoblast differentiation and cell senescence, respectively. Furthermore, CRISPR system can confer intra-G4 selectivity to G4-binding compounds PDC and PDS. Compared with traditional G4 ligands, CRISPR-guided Bio-PDC enables a more precise investigation into the biological functionality of de novo G4s. Our study provides insights that will enhance understanding of G4 functions and therapeutic interventions.

G-quadruplex

CRISPR

nucleolin

G4-stabilizing compounds

Bio-PDC

Single-stranded guanine-rich DNA sequences fold into stable intramolecular and intermolecular four-stranded non-B DNA structures called G-quadruplexes (G4s)¹. G4-forming sequences are pervasive in human genome². Natural G4s in genome involve in various crucial biological functions, thereby prompting the exploration of G4-related mechanisms as potential targets for therapeutic intervention, particularly in the context of cancer^3-5. G4s are transient and switch dynamically over time according to the local biological conditions, and endogenous proteins can regulate their folding/unfolding⁶^,⁷. G4 formation can be induced by G4-stabilizing proteins^8-10, while the helicases is responsible for unfolding G4 structures^11-14. Although DNA G4s are thought to involve in various biological processes¹⁵, in many cases their causative effects are largely unclear due to lack of suitable techniques for selectively folding or unfolding DNA G4 at specific loci. In principle, such technologies would promote developing G4-based disease therapy. Nonspecific methods for stabilization of DNA G4s by G4-binding ligands such as pyridostatin (PDS)^16-18, pyridodicarboxamide (PDC)^19-21 and their derivatives²²^,²³, have been commonly used to study the effects of DNA G4s. However, as most of these reagents display quite limited intra-G4 selectivity, it is difficult to study the effect of specific DNA G4 folding/unfolding events, and there is the risk of side effects for therapeutic use.

Recently, CRISPR technology has been adapted to recruit functional proteins or compounds to specific loci by fusion to catalytically inactive endonucleases²⁴^,²⁵. Just alteration of the target sequence in small guide RNAs (sgRNAs) is required to generate new catalytically inactive Cas9 (dCas9) for new genome loci²⁶^,²⁷. Thus, we speculate that a G4-stabilizing protein/ligand fused to dCas9 may promote the folding of DNA G4 in specific genome loci. Here, we investigate the possibility of manipulating the DNA G4 folding of specific genome loci by combining CRISPR with G4-stabilizing molecules.

Vectors

dCas9-nucleolin expression plasmids (to be added in Addgene)

lenti dCas9-nucleolin_Blast: 3rd generation lenti vector encoding dCas9-nucleolin with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)- nucleolin -2A-Blast-WPRE).

sgRNA expression plasmids (to be added in Addgene)

gRNA-humanized vector: Cloning was performed by linearization of the different restriction enzyme cutting sites (BbsI) and Gibson assembly-mediated incorporation of the sgRNA insert fragment.

dCas9-SunTag-mSA expression plasmids (to be added in Addgene)

pCAG-dCas9-SunTag-mSA: All in one vector which contains dCas9 peptide array (linker length: 22aa), antibody-mSA, and gRNA expression system.

pMD2.G (Addgene #12259)

psPAX2 (Addgene #12260)

Reagents

2× Hieff Canace^® AdvanceFast PCR Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd., 10163ES03)

BbsI-HF (New England BioLabs, R3539L)

AflII (New England BioLabs, R0520L)

T4 DNA Ligase Reaction Buffer (New England BioLabs, B0202S)

T4 DNA Ligase (New England BioLabs, M0202M)

Ampicillin (ST008; Beyotime, China)

Kanamycin (ST102; Beyotime, China)

E.coli DH5α competent cells (D1031S; Beyotime, China)

Lipofectamine™ 2000 Transfection Reagent (ThermoFisher Scientific, 11668500)

Puromycin (P8230; Solarbio Life Sciences, China)

Blasticidin (B9300; Solarbio Life Sciences, China)

Polybrene (C0351; Beyotime, China)

1. Design small guide RNA (sgRNA) sequences targeting DNA G4s at target genomic loci

This step is following the general sgRNA design in the CRISPR system. First, we should enter the sequence flanking the region where exists DNA G4 structure is to be removed into a sgRNA design tool such as CRISPRdirect (https://crispr.dbcls.jp/) for selection of a highly specific target sequence (20 mer). To more effectively stabilize the DNA G4 of interest, the sgRNAs should locate within the -150 bp to +150 bp window of DNA G4 sites. Given that the U6 promoter absolutely requires a guanine (G) at the transcription start site, we should append extra “G” base to 5′ end of the selected gRNA sequence. For inserting the sgRNA sequences into sgRNA expression plasmids, two DNA oligonucleotides including S or AS with sgRNA sequences could be synthesized, as shown below:

5’ CACCG-S 3’

3’ C-AS-CAAA 5’

For inserting the sgRNA sequences into dCas9-SunTag-mSA expression plasmids, two DNA oligonucleotides including S or AS with sgRNA sequences could be synthesized, as shown below:

5’ TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAAC

ACCG-S 3’

3’ C-AS-CAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCA5’

2. Preparation of the double-stranded oligonucleotide

For inserting the sgRNA sequences into sgRNA expression plasmids, perform annealing of each pair of oligonucleotides via reaction setup below:

Oligonucleotide S (100 μM): 5 μl;

Oligonucleotide AS (100 μM): 5 μL;

10 × PCR buffer (TAKARA): 2 μL;

ddH₂O: 8 μL;

Total: 20 μL.

Incubate at 95 ºC 10 min, cool down naturally to room temperature and dilute to 0.1 μM.

For inserting the sgRNA sequences into dCas9-SunTag-mSA expression plasmids, perform annealing of each pair of oligonucleotides via reaction setup below:

Oligonucleotide S (5 μM): 1 μl;

Oligonucleotide AS (5 μM): 1 μL;

2× Hieff Canace^® AdvanceFast PCR Master Mix: 5 μl;

ddH₂O: 3 μL;

Total: 10 μL.

Incubate at 98 °C for 30 s, 50 °C for 30 s, and 72 °C for 3 min. Then add 20 μl ddH₂O H₂O.

3. Preparation of sgRNA and dCas9-SunTag-mSA expression vectors

Insert the sgRNA sequences into sgRNA expression plasmids

a. Incubate 1 μg sgRNA expression vector with 1 μL BbsI at 37 °C for 4 h and then heat to 65 °C for 20 min to inactivate the enzyme.

b. Perform Inserting of sgRNA sequences into sgRNA expression plasmids via reaction setup below:

Mix of Oligonucleotide S+AS (0.1 μM): 5 μl;

Digested sgRNA expression plasmid: 200 ng;

T4 DNA Ligase: 1 μl;

T4 DNA Ligase Reaction Buffer: 1 μL;

ddH₂O: adjust the volume to 10 μl.

Incubate at 16 °C overnight.

c. Perform bacterial transformation using the reaction mixture described above (5 μl) into E.coli DH5α competent cells, and spread them over solid medium containing ampicillin to select for successfully transformed clones.

d. Pick 4~5 colonies and confirm the sequence by Sanger DNA sequencing using conventional human U6 sequencing primers.

e. Culture the colony containing the correct insert and purify the plasmid.

Insert the sgRNA sequences into dCas9-SunTag-mSA expression plasmids

a. Incubate 1 μg dCas9-SunTag-mSA expression vector with 1 μL AflII at 37 °C for 4 h and then heat to 65 °C for 20 min to inactivate the enzyme.

b. Perform Inserting of sgRNA sequences into sgRNA expression plasmids via reaction setup below:

Mix of Oligonucleotide S+AS: 0.5 μl;

Digested dCas9-SunTag-mSA expression plasmid: 100 ng;

2× Gibson Assembly Master Mix: 5 μl;

ddH₂O: adjust the volume to 10 μl.

Incubate at 50 °C overnight.

c. Perform bacterial transformation using the reaction mixture described above (2 μl) into E.coli DH5α competent cells, and spread them over solid medium containing kanamycin to select for successfully transformed clones.

d. Pick 4~5 colonies and confirm the sequence by Sanger DNA sequencing using conventional human U6 sequencing primers.

e. Culture the colony containing the correct insert and purify the plasmid.

4. Transfection of cells for G4s stabilization via dCas9-nucleolin and dCas9-SunTag-mSA/Bio-PDC

For dCas9-nucleolin mediated stabilization of G4 at specific genome loci, a typical transfection condition is described below (Using HEK293T cells as an example):

a. HEK293T cells were seeded to 70%-90% confluent in 60 mm culture dishes at the time of transfection.

b. Six µg of lenti dCas9-nucleolin_Blast or sgRNA expression vectors, 2 µg of pMD2.G, 4 µg of psPAX2 and 30 µL of Lipofectamine 2000 reagent were mixed in DMEM without serum.

c. The mixtures were incubated for 15-20 min at room temperature and added to cells in each dish. And then the media was changed 6 h after transfection.

d. Virus supernatant was harvested after 48 h, filtered through a 0.45 μM filter, and stored at -80 °C.

e. Virus supernatant was incubated on target cells (HEK293T) for 48 h at a 1:10 dilution with 8 μg/mL polybrene.

f. The infected cells were digested, counted, and re-seeded at low density in 60 mm culture dishes. After 6 h, the selection agents were added.

g. The duration of selection was 7 days for puromycin and blasticidin.

h. The HEK293T cells stably expressing dCas9-nucleolin and sgRNA were used to evaluate the stabilizaion of DNA G4 at specific genome loci by dCas9-nucleolin/sgRNA and investigate the roles of G4s in various of biological processes and the potential of G4s as therapeutic target of diseases.

For dCas9-SunTag-mSA/Bio-PDC mediated stabilization of G4 at specific genome loci, a typical transfection condition is described below (Using HEK293T cells as an example):

a. HEK293T cells were seeded to 60%-70% confluent in 24-well plates at the time of transfection.

b. For lipofectamine 2000 transfection reagent, dilute Lipofectamine 2000 (2 μl) in 50 μl DMEM medium without serum, and incubate at room temperature for 5 min.

c. Dilute plasmid DNA (1000 ng) in 50 μl DMEM medium without serum.

d. Add the diluted plasmid DNA to the diluted Lipofectamine 2000 reagent, and incubate for 15-20 min.

e. Add the DNA/Lipofectamine 2000 mixture to 24-well plates, and incubate the cells in 500 μl DMEM medium without serum for 6 h.

f. Remove the DMEM medium contain the DNA/Lipofectamine 2000 mixture, and then add the DMEM medium contain 10% fetal bovine serum and 500 nM Bio-PDC, and incubate for 48 h.

g. Two days post Bio-PDC treatment, cells could be harvested or proceed to downstream analysis.

1. Davis, J.T. G-quartets 40 years later: from 5'-GMP to molecular biology and supramolecular chemistry. Angewandte Chemie 43, 668-698 (2004).

2. Varshney, D., Spiegel, J., Zyner, K., Tannahill, D. & Balasubramanian, S. The regulation and functions of DNA and RNA G-quadruplexes. Nature reviews. Molecular cell biology 21, 459-474 (2020).

3. Kosiol, N., Juranek, S., Brossart, P., Heine, A. & Paeschke, K. G-quadruplexes: a promising target for cancer therapy. Molecular cancer 20, 40 (2021).

4. Carvalho, J., Mergny, J.L., Salgado, G.F., Queiroz, J.A. & Cruz, C. G-quadruplex, Friend or Foe: The Role of the G-quartet in Anticancer Strategies. Trends in molecular medicine 26, 848-861 (2020).

5. Qin, H., Zhao, C., Sun, Y., Ren, J. & Qu, X. Metallo-supramolecular Complexes Enantioselectively Eradicate Cancer Stem Cells in Vivo. Journal of the American Chemical Society 139, 16201-16209 (2017).

6. Lejault, P., Mitteaux, J., Sperti, F.R. & Monchaud, D. How to untie G-quadruplex knots and why? Cell chemical biology 28, 436-455 (2021).

7. Meier-Stephenson, V. G4-quadruplex-binding proteins: review and insights into selectivity. Biophysical reviews 14, 635-654 (2022).

8. Santos, T., Salgado, G.F., Cabrita, E.J. & Cruz, C. Nucleolin: a binding partner of G-quadruplex structures. Trends in cell biology 32, 561-564 (2022).

9. Pramanik, S. et al. The human AP-endonuclease 1 (APE1) is a DNA G-quadruplex structure binding protein and regulates KRAS expression in pancreatic ductal adenocarcinoma cells. Nucleic acids research 50, 3394-3412 (2022).

10. Roychoudhury, S. et al. Endogenous oxidized DNA bases and APE1 regulate the formation of G-quadruplex structures in the genome. Proceedings of the National Academy of Sciences of the United States of America 117, 11409-11420 (2020).

11. Mendoza, O., Bourdoncle, A., Boule, J.B., Brosh, R.M., Jr. & Mergny, J.L. G-quadruplexes and helicases. Nucleic acids research 44, 1989-2006 (2016).

12. van Schie, J.J.M. et al. Warsaw Breakage Syndrome associated DDX11 helicase resolves G-quadruplex structures to support sister chromatid cohesion. Nature communications 11, 4287 (2020).

13. Wu, G., Xing, Z., Tran, E.J. & Yang, D. DDX5 helicase resolves G-quadruplex and is involved in MYC gene transcriptional activation. Proceedings of the National Academy of Sciences of the United States of America 116, 20453-20461 (2019).

14. Chen, M.C. et al. Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36. Nature 558, 465-469 (2018).

15. Hansel-Hertsch, R., Di Antonio, M. & Balasubramanian, S. DNA G-quadruplexes in the human genome: detection, functions and therapeutic potential. Nature reviews. Molecular cell biology 18, 279-284 (2017).

16. Rodriguez, R. et al. A novel small molecule that alters shelterin integrity and triggers a DNA-damage response at telomeres. Journal of the American Chemical Society 130, 15758-15759 (2008).

17. Liu, L.Y., Ma, T.Z., Zeng, Y.L., Liu, W. & Mao, Z.W. Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G-Quadruplexes. Journal of the American Chemical Society 144, 11878-11887 (2022).

18. Hou, Y. et al. G-quadruplex inducer/stabilizer pyridostatin targets SUB1 to promote cytotoxicity of a transplatinum complex. Nucleic acids research 50, 3070-3082 (2022).

19. Verga, D., Hamon, F., Poyer, F., Bombard, S. & Teulade-Fichou, M.P. Photo-cross-linking probes for trapping G-quadruplex DNA. Angewandte Chemie 53, 994-998 (2014).

20. Masson, T. et al. BrdU immuno-tagged G-quadruplex ligands: a new ligand-guided immunofluorescence approach for tracking G-quadruplexes in cells. Nucleic acids research 49, 12644-12660 (2021).

21. Yang, P., De Cian, A., Teulade-Fichou, M.P., Mergny, J.L. & Monchaud, D. Engineering bisquinolinium/thiazole orange conjugates for fluorescent sensing of G-quadruplex DNA. Angewandte Chemie 48, 2188-2191 (2009).

22. De Cian, A., Delemos, E., Mergny, J.L., Teulade-Fichou, M.P. & Monchaud, D. Highly efficient G-quadruplex recognition by bisquinolinium compounds. Journal of the American Chemical Society 129, 1856-1857 (2007).

23. Lemarteleur, T. et al. Stabilization of the c-myc gene promoter quadruplex by specific ligands' inhibitors of telomerase. Biochemical and biophysical research communications 323, 802-808 (2004).

24. Konermann, S. et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517, 583-588 (2015).

25. Chiarella, A.M. et al. Dose-dependent activation of gene expression is achieved using CRISPR and small molecules that recruit endogenous chromatin machinery. Nature biotechnology 38, 50-55 (2020).

26. Qin, G., Yang, J., Zhao, C., Ren, J. & Qu, X. Manipulating complex chromatin folding via CRISPR-guided bioorthogonal chemistry. Proceedings of the National Academy of Sciences of the United States of America 119, e2204725119 (2022).

27. Wang, C. et al. dCas9-based gene editing for cleavage-free genomic knock-in of long sequences. Nature cell biology 24, 268-278 (2022).

28. Gilbert, L.A. et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451 (2013).

Download PDF

Version 1

posted

You are reading this latest protocol version

A step by step protocol for stabilizing specific DNA G-quadruplexes by CRISPR guided G-quadruplex binding proteins and ligands

Status:

Version 1

Abstract

Introduction

Reagents

Procedure

References

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

A step by step protocol for stabilizing specific DNA G-quadruplexes by CRISPR guided G-quadruplex binding proteins and ligands

Status:

Version 1

Abstract

Introduction

Reagents

Procedure

References

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Manage Cookie Preferences