Preparing Active Recombinant AEP free of Acid-activation.

doi:10.21203/rs.3.pex-1936/v2

Method Article

Preparing Active Recombinant AEP free of Acid-activation.

https://doi.org/10.21203/rs.3.pex-1936/v2

This work is licensed under a CC BY 4.0 License

This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.

Version 2

posted

You are reading this latest protocol version

Asparaginyl endopeptidase is a useful biocatalyst for site-specific protein bioconjugation. However, existing recombinant protocol is lengthy requiring cap removal of the zymogenic enzymes through acid activation and extra chromatographic steps. Here, we describe an activation-free approach for AEP preparation where the cap and core domains are prepared as separate entities during gene expression. An AEP variant from Oldenlandia affinis (OaAEP1b-C247A) can be prepared without the need of acid treatment giving a yield of ~1.5-2.2 mg of enzyme per litre of culture. Likely because of a decrease in chromatography time and an increase of homogeneity, activity of the split AEP was found to be ~3-fold higher than those obtained using existing protocols, highlighting its potential usefulness.

Biochemistry

Biological techniques

Asparaginyl endopeptidase (AEP)

transpeptidase

bioconjugation

enzyme purification

protein labelling

Asparaginyl endopeptidases (AEPs) are ideal catalysts for protein bioconjugation because they have a short recognition sequence and catalytic efficiency (1, 2). Contemporary research where AEP is applicable includes the study of post-translation modifications in cell biology research, protein-drug conjugation for the production of biopharmaceuticals, peptide-ligation for the semi-synthesis of proteins, bioconjugation to solid supports for the immobilisation of proteins (3, 4, 5). However, application of AEPs has been limited by their complex preparation protocol. The genes of recombinant AEPs are typically expressed in fusion with its cap domain which silences enzyme activity by blocking access to the active site (1, 6, 7). The cap domain, therefore, needs to be removed by a low pH treatment, which takes up to 2 hours and requires multiple chromatographic steps for purification (up to 4 steps) (1, 7). Here, we outline a new activation-free protocol for recombinant AEP preparation that prepares the core enzyme and cap domain as split entities (Figure 1). This simplified procedure enables core AEP to be prepared in no more than two chromatographic steps whilst offering excellent catalytic efficiency.

Deionised water (dH₂O) was obtained from an Elga^® PURELAB Chorus 2 system.

TCEP-HCl, kanamycine sulfate, imidazole were purchased from Fluorochem.

Ethylenediamine tetraacetic acid, disodium salt dihydrate (EDTA), sodium phosphate dibasic and sodium chloride were purchased from ThemoFisher Scientific.

Sodium acetate was purchased from Melford.

Peptide substrates were purchased from ISCA Biochemicals or GenScript or synthesised in situ.

Calcium chloride and isopropyl-β-D-thiogalactopyranoside (IPTG) was purchased from Melford^®

30% acrylamide/bis-acrylamide solution and SYBR safe was purchased from Merck Sigma-Aldrich.

Buffers, nucleotide triphosphate and PrimeSTAR Max DNA polymerase were purchased from Takara.

All restriction enzymes were purchased from ThermoFisher Scientific. NEBuilder® HiFi DNA assembly master mix was purchased from New England Biolabs.

The gene optimized for expression in E. coli, encoding a protein composed of a N-terminal His₆ tag, 76-residue human ubiquitin and OaAEP1-C247A (from residues 24-474) was inserted into the coding region (NcoI-NdeI) of the pET-28b (+) vector (Genscript).

Shaking incubator for bacterial growth

FPLC system including Ni sepharose and Superdex^®200 Prep Grade

Preparation of the plasmid

1. Amplify the genes of the hexahistidine-ubiquitin (His₆-Ub) tagged core OaAEP1-C247A and the cap domain by use of the following primers:

His₆-Ub tagged core OaAEP1-C247A

P1: AAGCTTGCGGCCGCACTCGAGGAGATCCGGCTGCTAACAAAGCC

P2: TCTCCTTCTTAAAGTTAAACAAAATTATTTCGGATCCTTAGTCGTTCGCCGGGTTGC

cap domain

P3: TTTGTTTAACTTTAAGAAGGAGATATCATATGAACTATACCAGCCTGGATGGTAACGC

P4: CTCGAGTGCGGCCGCAAGCTTTTACGGGATGCTCGCGCACG

2. Insert the PCR products into a pET28b vector by use of the Gibson Assembly and transform into DH5α E. coli. Confirm the DNA sequences by Sanger sequencing (e.g. through Eurofins Genomics).

3. Introduce the mutation D29E by use of the following primers:

P5: CGGCGAAGAAAGCGTGGGTACCCGTTG

P6: GTGCAGATATTCACCGGTCACGCGCGCCACC

4. Treat the PCR product with DpnI digest enzyme. Extracted plasmid from DNA agarose gel. Transformed the plasmid into DH5α E. coli. Confirm the DNA sequences by Sanger sequencing (e.g. through Eurofins Genomics).

Gene Expression

5. Introduce the plasmid to Shuffle^® T7 E. coli by heat-shock transformation.

6. Select a single colony from the agar plate to inoculate 10 mL of LB medium that is added with 50 μg/mL kanamycin and then incubate at 30 °C overnight (16-20h) with shaking at 220 rpm.

7. Inoculate the starter culture into a LB media that contains 50 μg/mL of kanamycin at a ratio of 1:100 (10 mL into 1 L) at 30 °C until an OD₆₀₀ value of 0.6-0.7 is reached.

8. Induce gene expression by adding IPTG (0.4 mM) at 16 °C for 18 h and isolate the cell pellet by centrifugation (500 rpm/min, 15 min, 4 °C).

AEP preparation

9. Resuspend the cell pellet from a 1.0 L culture in 20 mL of lysis buffer (50 mM sodium phosphate, 300 mM NaCl, pH 8.0) with lysozyme (0.1 mg/mL), PMSF (35 µg/mL), DNase I (5 μg/mL)

10. Sonicate on ice (Amplitude: 39 %, 5 min, 5 s pulse ON, 15 s OFF) and subject the lysate to centrifugation (27,000g, 4 °C, 15 min).

11. Introduce the supernatant to 2 mL of Ni-NTA resin (Bio-Rad) in a gravity flow column (Bio-Rad).

12. Wash the column three times with lysis buffer that contains 10 mM imidazole (15 mL each).

13. Elute the remaining bound protein with 15 mL of lysis buffer that contains 300 mM imidazole.

14. Concentrate the eluted protein using a VIVASPIN centrifugal filter (10 kDa MWCO) (Cytiva).

15. Purify by size exclusion chromatography (Superdex 75, GE Healthcare) that had been pre-equilibrated in 50 mM sodium acetate buffer (pH 4.0), 150 mM NaCl, 0.5 mM TECP and 1 mM EDTA.

16. Combine fractions of desired protein and concentrate using a VIVASPIN centrifugal filter (10 kDa MWCO) (Cytiva).

17. Store at -80 °C with 5% (v/v) glycerol.

18. Perform SDS-PAGE analysis and estimate enzyme concentration by nanodrop UV-Vis A₂₈₀ (Figure 2).

Kinetic characterisations

19. Check enzyme activity by performing peptide ligation assays in 100 μL reaction mixtures containing 50 mM Na₂HPO₄ (pH 7.0, 5 mM EDTA), supplemented with 1 mM peptide GLP, the AEP (10 or 40 nM) and peptide substrate (20 to 240 μM).

20. Perform each reaction in duplicate at 25 °C by use of the microplate reader (FLUOstar Omega).

21. Calculate reaction velocities by converting the slopes of fluorescence intensity change at 450 nm, which corresponds to the concentration increase of the ligated peptide product.

22. Fit data to equation 3 using GraphPad Prism 9.0.0 (GraphPad) to estimate the kinetic parameters (k_cat and K_M, Figure 3).

𝑣 = 𝑉_𝑚𝑎𝑥 [𝑆]/(𝐾_𝑀+[𝑆]) (3)

STEP: Gene expression

PROBLEM: No expression observed on SDS-PAGE

POSSIBLE REASON: Temperature for gene expression is too high/low; No/wrong antibiotic

SOLUTION: Bring to 30 °C; Check and use the correct antibiotic

PROBLEM: No colonies on the agar plate

POSSIBLE REASON: No/wrong antibiotic

SOLUTION: Check and use the correct antibiotic

PROBLEM: No colonies on the agar plate

POSSIBLE REASON: Pipette the plasmid up and down into the competent cell for mix

SOLUTION: Gently mix by flicking the tube bottom by finger

PROBLEM: No colonies on the agar plate

POSSIBLE REASON: Excessive plasmid added leading to the low transformation efficiency

SOLUTION: Diluted the stock plasmid to around 10 ng/μL and add 1 μL to the competent cell

STEP: Ni-NTA column

PROBLEM: Target protein stays in the pellet

POSSIBLE REASON: Incomplete cell lysis

SOLUTION: Set the off to 15 s and keep the cell lysate chilled during sonification; Ensure temperature remains at 16 °C after IPTG addition

PROBLEM: Proteins are not eluted

POSSIBLE REASON: Insufficient imidazole in elution buffer

SOLUTION: Bring imidazole concentration to 300 mM

STEP: Size exclusion chromatography

PROBLEM: SDS-PAGE illustrates two bands

POSSIBLE REASON: Two cut sites identified.

SOLUTION: Remove potential cut sites of AEP by performing site-directed mutagenesis described in “Preparation of the plasmid”

PROBLEM: Cap domain not isolated

POSSIBLE REASON: The buffer pH is too high

SOLUTION: Bring to pH 4.0

PROBLEM: Low protein yield from size exclusion chromatography

POSSIBLE REASON: Protein solution is over-concentrated after Ni-NTA, resulting in precipitation

SOLUTION: Keep protein concentration below 0.2 mg/mL

The whole procedure will take about 6-7 days: 2 days for gene cloning, 1 day for transformation, 2 days for gene expression, 1 day for protein purification.

Highly active OaAEP1 variant is anticipated.

1. Yang, R. et al. Engineering a Catalytically Efficient Recombinant Protein Ligase. Journal of the American Chemical Society 139, 5351-5358 (2017).

2. Cao, Y., Nguyen, G., Tam, J. & Liu, C. Butelase-mediated synthesis of protein thioesters and its application for tandem chemoenzymatic ligation. Chemical Communications 51, 17289-17292 (2015).

3. Rehm, F., Tyler, T., Yap, K., Durek, T. & Craik, D. Improved Asparaginyl‐Ligase‐Catalyzed Transpeptidation via Selective Nucleophile Quenching. Angewandte Chemie 133, 4050-4054 (2020).

4. Rehm, F. et al. Enzymatic C-Terminal Protein Engineering with Amines. Journal of the American Chemical Society 143, 19498-19504 (2021).

5. Rehm, F. et al. Site-Specific Sequential Protein Labeling Catalyzed by a Single Recombinant Ligase. Journal of the American Chemical Society141, 17388-17393 (2019).

6. Chen, Y. et al. Site-Specific Protein Modifications by an Engineered Asparaginyl Endopeptidase from Viola canadensis. Frontiers in Chemistry 9, (2021).

We would like to thank for the financial support provided by BBSRC (BB/T015799/1) for Louis Y. P. Luk as well as the UKRI PhD studentship for T. M. Simon Tang (1928909).

Download PDF

Version 2

posted

You are reading this latest protocol version

Preparing Active Recombinant AEP free of Acid-activation.

Status:

Version 2

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Troubleshooting

Time Taken

Anticipated Results

References

Acknowledgements

Associated Publications

Status:

Version 2

Privacy Policy

Terms of Service

Preparing Active Recombinant AEP free of Acid-activation.

Status:

Version 2

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Troubleshooting

Time Taken

Anticipated Results

References

Acknowledgements

Associated Publications

Status:

Version 2

Privacy Policy

Terms of Service

Manage Cookie Preferences