Protocol Exchange

Author Information

Subject Terms

Keywords

Abstract

Introduction & Materials

Procedures

Outcomes

Conflicting Financial Interests

Associated Publications

Supplementary Files

Figures

Mizuki Honda

Shinya Oki

Ryuichi Kimura

Akihito Harada

Kazumitsu Maehara

Kaori Tanaka

Chikara Meno

Yasuyuki Ohkawa

Transcrptome analysis via photo-isolation chemistry

Basic Reagents	-	Nuclease-free water (Nacali Tesque, cat. no. 06442-95)-	Phosphate Buffered Saline (PBS) Tablets, pH7.4 (TaKaRa, cat. no.T9181)-	O.C.T compound (Sakura Finetek Japan, cat. No. 4583)-	Dry ice-	iso-Pentane&nbsp;(Nacali Tesque, cat. no. 26404-75)-	Triton X-100 (Nacali Tesque, cat. no. 35501-02)-	Polyoxyethylene Sorbitan Monolaurate (Tween-20) (Nacali Tesque, cat. no. 28353-85)-	5 mol/l-Hydrochloric Acid (5 N HCl) (Nacali Tesque, cat. no. 7647-01-0)-	1 mol/l-Tris (hydroxymethy) aminomethane-Hydrochloride Buffer Solution (pH8.0) (Nacali Tesque, cat. no. 06938-15)-	16% Formaldehyde (w/v), Methanol-free (Thermo; cat. no. 28906)-	0.1%-tTBS (10x TBST) (pH 7.4) (Nacali Tesque, cat. no. 12750-81)-	Blocking One-P (Nacali Tesque, cat. no. 05999084)-	5 mol/l-Sodium Chloride Solution (5 M NaCl) (Nacali Tesque, cat. no. 06900-14)-	Potassium Acetate (Nacali Tesque, cat. no. 28404-15)-	Magnesium Acetate Tetrahydrate (MgOAc)&nbsp;(Nacali Tesque, cat. no. 20821-85)-	0.5 mol/l-EDTA Solution (pH 8.0)&nbsp;&nbsp;(Nacali Tesque, cat. no. 06894-85)-	50% w/v Polyethylene Glycol 8,000 (Nacali Tesque, cat. no. 26065-54)-	Proteinase K solution (20 mg/ml) (KANTO CHEMICAL CO., INC. cat. no. 34060-96)-	Qiagen MinElute PCR Purification kit (QIAGEN, cat. no. 28006)-	SuperScript II Reverse Transcriptase (Thermo, cat. no. 18064071)-	5xFirst Strand Buffer (Thermo, cat. no. 18064071)-	0.1 M DTT (Thermo, cat. no. 18064071)-	RNaseOUT (Thermo, cat. no. 10777019)-	Deoxynucleotide (dNTP) Solution Mix (NEB, cat. no. N0447L)-	Second Strans Buffer (Thermo, cat. no. 10812014)-	DNA Polymerase I (E.coli)&nbsp;(Thermo, cat. no. 18010025)-	E.coli DNA ligase (Thermo, cat. no. 18052019)-	RNaseH (E.coli) (Thermo, cat. no. 18021071)-	MEGAscript T7 Transcription Kit (Thermo, cat. no. AMB13345)-	ExoSAP-IT Express PCR Product Cleanup (Thermo,cat. no. 75001.1.ML)-	AMPure XP beads (Beckman Coulter, cat. no. A63881)-	RNAClean XP beads (Beckman Coulter; cat. no. A63987)-	Ethanol (96-100% (vol/vol)) (Nacali Tesque, cat. no.14713-95)-	Nuclear Violet LCS1 (AAT Biooquest, Inc, cat. no. 17543)-	SlowFade Diamond (Thermo, cat. no. S36963)-	Pusion High-Fidelity PCR Master Mix (NEB, cat. no. M0531L) Reagent setup-	Phosphate-buffer saline (PBS) : Dissolve 1 tablet of Phosphate Buffered Saline (PBS) Tablet, pH7.4 in 1000 ml of&nbsp;dH2O, and autoclave-	4% PFA in PBS : Mix 1 ml 16% Formaldehyde (w/v), Methanol-free&nbsp;and PBS-	10% (vol/vol) Triton X-100 : Dilute 5 ml of Triton X-100 with Nuclease-free water to a final volume of 50 ml-	5% (vol/vol) Triton X-100 in PBS : Mix 1 ml of 10% (vol/vol) Triton X-100 with 1 ml of PBS-	10% (vol/vol) Tween-20 : Dilute 5 ml of Tween-20 with Nuclease-free water to a final volume of 50 ml-	0.1 N HCl in Nuclease-free water : Mix 200 ml of 5 N HCl with 9.8 ml Nuclease-free water-	1xTBST : Mix 5ml of 10xTBST with 45 ml of&nbsp;Nuclease-free water-	Proteinase K lysis solution : Mix 970 μl of PBS, 10 μl of 10% Tween and 20 μl of Proteinase K (20mg/mL)-	Blocking solution&nbsp; : Mix 5 ml of Blocking One-P with 5 ml of 1xTBST-	1 M KOAc : Dissolve 19.63 g of Potassium Acetate&nbsp;in dH2O, make up to a final volume of 200 ml, and autoclave-	1.5 M MgOAc : Dissolve 64.35 g of Potassium Acetate&nbsp;in dH2O, make up to a final volume of 200 ml, and autoclave-	Beads binding buffer : Mix 4 ml of 50% w/v Polyethylene Glycol 8,000 , 5 ml of 5M NaCl, and 1 ml of Nuclease-free water-	Fragmentation Buffer : Mix 5 ml of 1M KOAc, 1 ml of 1.5 M MgOAc, 2 ml of 1M Tris-HCl (pH8.0), and 2 ml of Nuclease-free water-	80% Ethanol : Mix 40 ml of Ethanol (96-100% (vol/vol))&nbsp;and 10 ml of Nuclease-free water-	70% Ethanol : Mix 35 ml of Ethanol (96-100% (vol/vol))&nbsp;and 15 ml of Nuclease-free water Oligos	t = NPOM-caged dT-	Caged Oligo DNA ;	5'- GCCGGTAATACGACTCACTATAGGGtttGAGttCtACAGTCCGACGATCNNNNNNTCGAAGttTTTTTTTTTTTTTTTTTTTTTTV-3'-	RandomhexRT ; 5'- GCCTTGGCACCCGAGAATTCCANNNNNN -3'-	RNA PCR primer 1 ;	AATGATACGGCGACCACCGAGATCTACACAATACATCGTTCAGAGTTCTACAGTCCGA-	RNA PCR primer 2 ; CAAGCAGAAGACGGCATACGAGATAGTGCTTCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA

-	PAP PEN (BMS, cat. no. BC-PAPPEN-S)-	Cryostat (Leica)-	Leica DM5000 B fluorescence microscope&nbsp;with an EL6000 100E Hg lamp (100% power) and a Leica A filter cube (11513873) at a wavelength of 340–380 nm&nbsp;-	Polypropylene staing jar&nbsp;(Thermo, cat. no. 1-7934-01)-	Hybridization oven (TAITEC, cat. no. HB-80)-	Humidified chamber&nbsp;&nbsp;(Cosmo Bio Co., Ltd., cat. no. 10HTLS )-	NGS Magna Stand 96 well (NIPPON Genetics Co., Ltd. , cat. no. FD-SSMAG96)&nbsp;-	Thermal cycler (Applied Biosystems)- Bioanalyzer 2100 (Agilent Technologies)- Library Quantification Kit (Clontech, cat. No. 638324)

Preparation of Fresh Frozen Sections1	Crush dry ice into pieces of 2-3 cm in size2	Put the crushed dry ice lumps into a 100 ml beaker, then fill it with iso-pentane3	Put the dissected tissues into an embedding container filled with O.C.T compound4	Flash-freeze the tissues by submerging into the iso-pentane cooled with dry ice.5	Make the sections at a thickness of 10 μm with a cryostat and mount them on MAS-coated glass slides (Matsunami).Note:	Subsequent processing can be facilitated by creating the hydrophobic barriers around the sections with a pap pen facilitates Fixation and permeabilization6	Wash the tissue sections twice with PBS to remove the O.C.T compound7	Fix the sections with 4% PFA in PBS for 10 min at room temperature8	Wash the sections twice with PBS&nbsp;9	Incubate the sections for 3 min with PBS containing 3% Triton X-100 at room temperature10	Wash the sections twice with PBS&nbsp;11	Incubate the sections with 0.1N HCl in nuclease-free water for 5 min at room temperature12	Remove the supernatant13	Incubate the sections with 1M Tris-HCl (pH8.0) for 5 min at room temperature14	Wash the sections twice with PBS&nbsp;15	Immerse the sections in PBS preheated to 65°C in a staining jar and incubate in a hybridization oven for 5min16	Immerse the sections in a staining jar containing chilled PBS&nbsp; In situ RT	17	Mix 0.5 μl of 500 ng/μl caged Oligo DNA, 0.5 μl of 10 mM dNTPs, and 5 μl of nuclease-free water in a 0.2 ml tube, and heat to 65°C and then quickly cool to 4°C using Thermal cycler18	Add 2 μl of 5× First Strand Buffer, 1 μl of 0.1 M DTT, 0.5 μl of 40 U/μl RNase Out, and 0.5 μl of 200 U/μl Superscript II Reverse Transcriptase to the primer mix prepared above (17)19	Drop 10 μl of the RT mix prepared above (18) onto the section and seal with a coverslip20	Incubate the sections at 42 °C for 1 hr in a PBS-humidified chamber21	Immerse the sections in PBS preheated to 70 °C in a staining jar and keep at 70 °C in a hybridization oven for 10min22	Immerse the sections in a staining jar cold containing chilled PBS&nbsp;23	Wash the sections twice with PBS&nbsp; Option : Immunostaing	24	Incubate the sections for 15 min with blocking solution at room temperature25	Incubate the sections with primary antibodies diluted in blocking solution for 2 hr at room temperature or overnight at 4 °C in a hybridization oven26	Wash the sections three times with TBST27	Incubate the sections with 2nd antibodies diluted in blocking solution for 1 hr at room temperature or overnight at 4 °C in a hybridization oven28	Wash the sections three times with TBST29	Incubate the sections with Nuclear Violet LCS (1:1000) with blocking solution for 15 min at room temperature in a hybridization oven30	Mount the sections with SlowFade Diamond before coverslipping UV irradiation	31	Irradiate 365 nm-centered UV light to the ROIs for 15 minNote:	Since the caged compound (NPOM) used in PIC is cleaved most efficiently at 365 nm, the irradiation can be performed with the fluorescence filter cube that are conventionally used to excite nuclear staining dyes with blue fluorescence such as DAPI and Hoechst. We used Leica A filter cube (#11513873; 340–380 nm excitation) for uncaging under a Leica DM5000 B fluorescence microscope illuminated with an EL6000 100 W Hg lamp.&nbsp; Cell lysis	32	Strip the cover slip, and wash the sections three times with PBS33	Drop 40 μ l of proteinase K lysis solution to the sections34	Incubate the sections in a hybridization oven at 42 °C for 30 min35	Scrape the sections and collect the cell lysates and debris in a 1.5 ml tube36	Drop 40 μl of proteinase K lysis solution to the section, again37	Incubate the sections in a hybridization oven at 42 °C for 30 min, again38	Collect the cell lysates and debris in the same tube as (36) (total volume ≃ 80 μl)39	Incubate for 30 min at 55 °C40	Purify cDNA:mRNA hybrids with Qiagen MinElute PCR Purification kit41	Elute with 15 μl of nuclease-free water Second-strand DNA synthesis	42	Mix the eluted 15 μl of cDNA:mRNA hybrids with 2 μl of 5xFirst Strand Buffer, 2.31 μl&nbsp;of 5x Second Strand Buffer, 0.23 μl of 10 mM dNTPs, 0.08 μl of E.coli DNA ligase (10 U/μl), 0.3 μl of E.coli DNA polumerase (10 U/μl) and 0.08 μl of E.coli RNaseH (2 U/μl)43	Incubate for 2 hr at 16 °C44	Mix 20 μl of second-strand DNA sample and 24 μl of Ampure binding buffer mix (Ampure XP beads : Beads binding buffer = 1 : 5) and vortex thoroughly45	Incubate for 15 min at room temperature46	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature47	Remove the supernatant48	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature49	Remove the supernatant50	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature51	Remove the supernatant52	Spin down the sample tube53	Place the sample tube on the magnetic stand and incubate for 2 min at room temperature54	Remove the supernatant and air dry55	Suspend the beads with 6.4 μl of nuclease-free water by pipetting in virto transcription	56	Mix the 6.4 μl of beads suspension containing double-strand cDNAs with 1.6 μl of ATP, 1.6 μl of GTP, 1.6 μl of CTP, 1.6 μl of UTP, 1.6 μl of 10xT7 reaction buffer, and 1.6 μl of T7 Enzyme&nbsp;from the MEGAscript T7 Transcription Kit57	Incubate for 17 hr at 37 °C58	Add 1 μl of TURBO DNase from the MEGAscript T7 Transcription Kit and incubate for 15 min at 37 °C59	Add 3 μl of ExoSAP-IT Express PCR Product Cleanup and incubate for 5 min at 37 °C60	Add 5.5 μl of fragmentation Buffer and incubate for 3 min at 94 °C and quickly cool to 4°C using Thermal cycler61	Place the sample tube on ice and add 2.75 μl of 0.5 M EDTA pH8.062	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature63	Collect 28 μl of supernatant in a new 0.2 ml tube aRNA Cleanup	64	Mix 28 μl of aRNA samples with 50.4 μl of RNAClean XP beads and vortex thoroughly65	Incubate for 10 min at room temperature66	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature67	Remove the supernatant68	Add 200 μl of 70% Ethanol and incubate for 30 sec at room temperature69	Remove the supernatant70	Add 200 μl of 70% Ethanol and incubate for 30 sec at room temperature71	Remove the supernatant72	Spin down the sample tube73	Place the sample tube on the magnetic stand and incubate for 2 min at room temperature74	Remove the supernatant and air dry75	Suspend the beads with 7 μl of nuclease-free water by pipetting76	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature77	Collect 5 μl of supernatant in a new 0.2 ml tube Library preparation	78	Mix eluted 5 μl of aRNAs with 1 μl of RandomhexRT (250 ng) and 0.5 μl of 10 mM dNTPs&nbsp;79	Heat the tubes at 65°C and then quickly cool to 4°C using Thermal cycler80	Add 2 μl of 5× First Strand Buffer, 1 μl of 0.1 M DTT, 0.5 μl of 40 U/μl RNase Out, and 0.5 μl of 200 U/μl Superscript II Reverse Transcriptase81	Incubate for 10 min at 25°C, then for 1 hr at 42°C82	Add 8.4 μl of nuclease-free water, 1.8 μl of RNA PCR primer 1 (10 μM), 1.8 μl of RNA PCR primer 2 (10 μM) and 22.5 μl of Pusion High-Fidelity PCR Master Mix83	Amplify by PCR (98°C for 30 s, followed by 11 cycles of 98°C for 10 s, 60°C for 30 s and 72°C for 30 s, with final extension at 72°C for 10 min)84	Add 1 μl of RNaseA (10 mg/ml) and incubate for 30 min at 37 °C85	Add 6 μl of nuclease-free water and 32.5 μl Ampure XP beads, and vortex thoroughly86	Incubate for 15 min at room temperature87	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature88	Collect the supernatant in a new 0.2 ml tube89	Add 12.5 μl Ampure XP beads, and vortex thoroughly90	Incubate for 10 min at room temperature91	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature92	Remove the supernatant93	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature94	Remove the supernatant95	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature96	Remove the supernatant97	Spin down the sample tube98	Place the sample tube on the magnetic stand and incubate for 2 min at room temperature99	Remove the supernatant and air dry100	Suspend the beads with 32 μl of nuclease-free water by pipetting101	Incubate for 2 min at room temperature102	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature103	Collect 30 μl of supernatant in a new 0.2 ml tube104	Add 19.5 μl Ampure XP beads, and vortex thoroughly105	Incubate for 15 min at room temperature106	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature107	Collect the supernatant in a new 0.2 ml tube108	Add 7.5 μl Ampure XP beads, and vortex thoroughly109	Incubate for 10 min at room temperature110	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature111	Remove the supernatant112	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature113	Remove the supernatant114	Add 200 μl of 80% Ethanol and incubate for 30 sec at room temperature115	Remove the supernatant116	Spin down the sample tube117	Place the sample tube on the magnetic stand and incubate for 2 min at room temperature118	Remove the supernatant and air dry119	Suspend the beads with 17.5 μl of nuclease-free water by pipetting120	Place the sample tube on the magnetic stand and incubate for 5 min at room temperature121	Collect 15 μl of supernatant in a new 0.2 ml tube122 Quantify cDNA library using&nbsp;high-sensitivity DNA chips on a Bioanalyzer 2100&nbsp;and&nbsp;Library Quantification Kit&nbsp;&nbsp;123 Sequence with Illumina sequencer (1–3 million reads per sample)124 Analyze the sequence data according to CEL-seq2 protocol (Hashimshony, T. et al. Genome Biol&nbsp;2016)

CC BY 4.0

To gain insights into tissue-specific gene expression in multicellular systems, gene expression profiles are required to be precisely linked with spatial information. Here, we establish a hight-depth spatial transcriptomics method, photo-isolation chemistrty (PIC), which is able to isolate gene expression profiles only from UV-irradiatied region out of whole tissue section. This method performs reverse transcription on tissue sections using photocaged oligo DNAs. After the UV irradiation, the cDNAs in the irradiated regions are allowed to be amplified and sequenced, thereby&nbsp;providing gene expression profiles linked with spatial information.

Transcrptome analysis via photo-isolation chemistry

Research Square

Biological techniques

Systems biology

An open repository of community-contributed protocols sponsored by Nature Research.

Learn more about Protocol Exchange

Method Article

Mizuki Honda, Shinya Oki, Ryuichi Kimura, Akihito Harada, Kazumitsu Maehara, Kaori Tanaka, Chikara Meno, Yasuyuki Ohkawa

Mizuki Honda

Kyoto University

ORCiD: https://orcid.org/0000-0003-3988-0802

Shinya Oki

Kyoto University

Corresponding Author

ORCiD: https://orcid.org/0000-0002-4767-3259

Ryuichi Kimura

Kyoto University

Akihito Harada

Kyushu University

Kazumitsu Maehara

Kyushu University

Kaori Tanaka

Kyushu University

Chikara Meno

Kyushu University

Yasuyuki Ohkawa

Kyushu University

Corresponding Author

ORCiD: https://orcid.org/0000-0001-6440-9954

DOI:

10.21203/rs.3.pex-1564/v1

Download PDF

License:

This work is licensed under a CC BY 4.0 License. Read Full License

Abstract

Keywords

RNA-seq, SpatialTranscriptome, caged compound

Reagents

Equipment

Procedure

Comments

Version History

CURRENT STATUS: Posted

Version 1

No community comments so far

Metrics

Comments: 0

HTML Views: ...

Subject Areas

Biological techniques

Systems biology

An open repository of community-contributed protocols sponsored by Nature Research.

Learn more about Protocol Exchange

Method Article

Mizuki Honda, Shinya Oki, Ryuichi Kimura, Akihito Harada, Kazumitsu Maehara, Kaori Tanaka, Chikara Meno, Yasuyuki Ohkawa

Mizuki Honda

Kyoto University

ORCiD: https://orcid.org/0000-0003-3988-0802

Shinya Oki

Kyoto University

Corresponding Author

ORCiD: https://orcid.org/0000-0002-4767-3259

Ryuichi Kimura

Kyoto University

Akihito Harada

Kyushu University

Kazumitsu Maehara

Kyushu University

Kaori Tanaka

Kyushu University

Chikara Meno

Kyushu University

Yasuyuki Ohkawa

Kyushu University

Corresponding Author

ORCiD: https://orcid.org/0000-0001-6440-9954

Badges

Peer Review Timeline

Version History

CURRENT STATUS: Posted

Version 1

No community comments so far

Metrics

Metrics