All steps up to and including reverse transcription should be carried out in an RNase-free environment using RNase-free reagents, tubes, and barrier pipette-tips.
Recipes
Reference Mix
1. Mix the following ingredients to form 1000 µl of the reference [email protected]
a. 992µl TE8
b. 2µl Ref_ZStop_W_R6R30m_X [email protected]µM
c. 2µl Ref_ZStop_W_R6R30n_X_cut [email protected]µM
d. 2µl Ref_ZStop_clvd_R6R30o_X [email protected]µM
e. 2µl Ref_ZStop_clvd_R6R30p_X_lig_cut [email protected]µM
2. Dilute the reference mix to 50pM by mixing 2µ[email protected] and 798µl of TE8 in a DNA Lo-Bind Eppendorf tube.
PCR1 Oligo Mix
1. Mix the following ingredients to form 250µl of the PCR1 oligo mixture @4x
a. 225µl TE8
b. 5µl WFU [email protected]µM
c. 5µl ZFC [email protected]µM
d. 5µl XRC [email protected]µM
e. 10µl RD1 [email protected]µM
Library Preparation
1. Prepare library of transcription templates based on the sTRSV ribozyme with chosen loop sequences and preceded by the T7 RNA polymerase’s promoter sequence.
2. Synthesize the library as a pool of oligonucleotides in the reverse-complement direction.
3. For example, for the native ribozyme, sTRSV, in this context, use the sequence: < TTTTTATTTTTCTTTTT GCTGT TTC GTCC TCAC GGAC TCATCAG ACCGGA AAGCACA TCCGGT G ACAGC TTTGTTTGTTT CCC TATAGTGAGTCGTATTAAATT >. Desired sequences, which may contain aptamers, replace the loop sequences, TCAC and AAGCACA, above (in reverse-complement orientation).
4. Anneal the library to an equimolar solution of the T7 promoter in the forward direction to allow runoff transcription.
5. Dilute the library to a concentration of 10nM in TE8.
Transcription
1. Prepare enough transcription master [email protected] for N reactions, by mixing in the following order:
a. water to bring the total volume to 8N µl
b. 2.0N µl of 10x RNA Pol Buffer
c. 1.8N µl of [email protected]
d. 0.4N µl of [email protected]
e. 2.0N µl of T7 RNA [email protected]/µl
2. Add the following ingredients in the listed order in one PCR tube per reaction:
a. water to bring the total volume to 20µl
b. 2 µl of the above library
c. up to 11.8 µl of target chemical(s) (if chemicals are in DMSO, limit to 2µl to keep final DMSO concentration <= 10%)
d. 8µl of 2.5x transcription master mix
3. Vortex briefly and spin down mixtures.
4. Incubate at 37ºC for 30 minutes
5. Spin down products.
Reverse Transcription
1. While transcription is running, prepare 4µl/reaction of RT master mix @2x concentration, by mixing in the following order:
a. 0.72N µl water to bring the total volume to 4N µl
b. 0.8N µl of Omniscript [email protected]
c. 0.8N µl of Omniscript [email protected]
d. 1.28N µl of [email protected]
e. 0.4N µl of Omniscript [email protected]/µl
2. Remove 2µl of each transcription reaction to clean PCR tubes.
3. Add 2µl of stop oligonucleotide @4µM to each tube.
4. Vortex briefly and spin down mixture.
5. Add 4µl of RT master mix to each reaction
6. Vortex briefly and spin down mixture.
7. Incubate at 50ºC for 20 minutes.
8. Heat inactivate enzyme and refold cDNA at 95ºC for 2 minutes.
9. Spin down products.
Ligation
1. While reverse transcription is running, prepare 4µl/reaction of ligation master [email protected] concentration, by mixing in the following order:
a. 1.0N µl water
b. 2.0N µl T4 DNA Ligase [email protected]
c. 1.0N µl T4 DNA [email protected]/µl
2. Add 8µl of water to the same tubes use for the reverse transcription.
3. Add 4µl of the ligation master mix to each reaction.
4. Vortex briefly and spin down mixture.
5. Incubate at 37ºC for 15 minutes
6. Heat inactivate enzyme at 65ºC for 10 minutes.
7. Spin down products.
UDG/Exo digestion
1. While ligation is running, prepare 8µl/reaction of digestion master [email protected], by mixing in the following order:
a. 6.4N µl of water
b. 1.0N µl of Thermo Pol [email protected]
c. 0.4N µl of Reference [email protected]
d. 0.1N µl of [email protected]/µl
e. 0.1N µl of Endoncuclease [email protected]/µl
2. Dilute ligation products 25x by adding 6µl of each reaction to a new PCR tube containing 144µl of TE8.
3. Vortex briefly and spin down mixtures.
4. Add 2µl of each reaction to 8µl of digestion master [email protected] in a new PCR tube.
5. Vortex briefly and spin down mixtures.
6. Incubate at 37ºC for 15 minutes.
7. Heat inactivate enzymes at 85ºC for 20 minutes.
8. Spin down products.
NGS Adapter Addition
1. While digestion is running, prepare 4µl/reaction of PCR1 master [email protected], by mixing in the following order:
a. 0.37N µl of water
b. 0.08N µl of Thermo Pol [email protected]
c. 0.08N µl of [email protected]
d. 0.08N µl of Salmon Sperm [email protected]µg/ml
e. 0.04N µl of PCR1 oligonucleotide [email protected]
f. 0.02N µl of Hot-Start [email protected]
2. Add 4µl of PCR1 master mix to each digestion reaction in the same PCR tube.
3. Vortex briefly and spin down mixtures.
4. Run the following PCR cycling: (PCR1)
a. Activation for 30s at 95ºC
b. Repeat for 5 cycles:
i. 30s at 95ºC
ii. 30s at 57ºC
iii. 30s at 68ºC
c. 60s at 68ºC
d. Hold at 4ºC
5. Dilute each tube 10x in place by adding 126µl of water, vortex briefly and spin down.
6. Spin down products.
NGS Index Addition
1. While PCR1 is running, prepare 16.7µl/reaction of PCR2 master [email protected], by mixing in the following order:
a. 10.4N µl of water
b. 5.0N µl of Kapa HiFi [email protected]
c. 0.75N µl of Kapa dNTP’[email protected]
d. 0.5N µl of Kapa HiFi [email protected]
2. Also, prepare a 6.25x dilution of the NEBNext Unique Dual Index Primer Pairs by diluting in TE8 and aliquoting 6.25µl/well to new plates for future use.
3. In clean PCR tubes, add the following:
a. 16.7µl of PCR2 master [email protected]
b. 6.25µl of a unique dual index primer [email protected]µM each (this is a 6.25x dilution of the stock dual index primers); each sample should use a distinct primer pair.
c. 2µl of the diluted product from PCR1
4. Vortex briefly and spin down mixtures.
5. Run the following PCR cycling: (PCR2)
a. Activation for 180s at 95ºC
b. Repeat for 14 cycles:
i. 30s at 98ºC
ii. 30s at 64ºC
iii. 30s at 72ºC
c. 60s at 72ºC
d. Hold at 4ºC
6. Perform a 1.8 Ampure cleanup of products using manufacturer’s instructions, elute products in 30µl of TE8.
7. Quantify products using Kapa Quantification Kit using manufacturer’s instructions
a. Expect each product to be 2-20nM
Sequencing Library Mixdown
1. Mix products above such the number of moles added to the mixture correspond to the relative number of NGS reads that are desired for each condition. For equal coverage the mixture should include the same number of moles of each component. A minimum of 50 usable reads per library entry is required and >100 is preferable. Note that after removal of low-quality reads, single-base errors, references, amplicons, and other undesired sequences, approximately half of the total reads are typically usable.
2. Compute the concentration of the mixture based on the contribution of each component.
3. Dilute the mixture with TE8 to the required concentration for the sequencing platform of choice. For example, for iSeq, dilute to 100pM, for other Illumina platforms dilute to 4nM.
4. Addition of ~10% PhiX to the library is recommended to reduce issues related to amplicon sequencing on Illumina platforms.
Sequencing
Sequencing should be performed using paired-end reads long enough to read the entirety of the longest library entry including prefixes, suffixes and an overlap of at least 10nt for the two reads. Typically, 2x75 is adequate for short loop sequences (<40 nt in the two loops combined), or 2x150 for longer libraries. Both indexes should also be read using 8 cycles each.
Data Analysis
The sequencing data should be demultiplexed into separate fastq files for each of the dual unique indexes by the sequencing platform such as Illumina basespace. Following this, the following steps should be performed:
1. Paired reads can be assembled using PEAR2
2. Joined fastq files can be preprocessed to form a text file of total reads of each unique sequence in each file. This can be done using shell scripts (such as fastq2counts.sh from http://github.com/btownshend/NGSDatabase ) or other tools.
3. For each sequence in the library, there will be reads of that sequence prefixed by one of two sequences. Reads corresponding to uncleaved RNA will be prefixed the same as they were in the input library: <GGGGAAACAAACAAA>. Reads corresponding to cleaved RNA will be prefixed with <GGGGACAAAACAAAAC>. For each sequence, find the counts, Nc and Nu, of cleaved and uncleaved reads.
4. Calculate cleavage of each sequence as Nc/(Nc+Nu).
5. Compare cleavage of each sequence under each condition tested. For example, if one condition included no added chemicals and another had a chemical addition, then the ratio of cleavages in those two conditions, which mapped to different fastq files from the demultiplexing, will give the fold change due to addition of the chemical.