Method Article
T-cell tailored single-cell RNA barcoding and sequencing (tSCRB-seq)
https://doi.org/10.21203/rs.3.pex-1289/v1
This work is licensed under a CC BY 4.0 License
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version
tSCBR-seq is a T-cell tailored plate-based single-cell RNA sequencing protocol with superior mRNA capturing efficacy and dynamic range of gene detection. This was achieved through a series of chemical modifications of the original SCBR-seq protocol published by Soumilon and colleagues [1]. The performance of the protocol was also demonstrated in the article “Proliferation-competent Tcf1+ CD8 T cells in dysfunctional populations are CD4 T cell help independent” [2].
RNaseZap - RNase Decontamination Solution
AM9780, Invitrogen
FrameStar 96-Well Semi-Skirted PCR Plate, low binding
4ti-LB0770/C, 4titude
Buffer TCL*
1031576, Qiagen
2-Mercaptoethanol, molecular biology grade
63689-25ML-F, Sigma
Adhesive PCR Foil Seals**
4TI-0550, 4titude
Dry ice
various vendors
RNAClean XP beads*
A63987, Beckman Coulter
Absolute Ethanol, molecular biology grade
BP2818500, Fisher BioReagents
25 ml Reagent Reservoir, PS, sterile
various vendors
NxGen RNAse Inhibitor
30281-2, Lucigen
Maxima H Minus Reverse Transcriptase
EP0753, Thermo Fisher Scientific
Advantage® UltraPure PCR Deoxynucleotide Mix (10 mM each dNTP)*
639125, Takara
KAPA HiFi HotStart ReadyMix*
7958935001, KAPA Biosystems
AMPure XP*
A63881, Beckman Coulter
High Sensitivity DNA Kit (Chips & Reagents)
5067-4626, Agilent
Nextera XT DNA Library Preparation Kit*
FC-131-1024, Illumina
Water, molecular biology grade
various vendors
Filter tips (10μl, 20μl and 1000μl)
various vendors
1.5 ml DNA LoBind Tubes
022431021, Eppendorf
2.0 ml DNA LoBind Tubes
022431048, Eppendorf
0.2 ml 8-Tube Strips (with attached caps)
various vendors
PCR Seal
4ti-0500, 4titude
PCR Seal perforated for tearing into part plates or 8 well strips
4ti-0500/8, 4titude
Segmented PCR plates, 3x8 wells
4ti-0750/24, 4titude
Filter pipette tips
various vendors
* Do not replace.
** Make sure it remains sealed upon plate storage at -70oC.
Primers:
SCRB-seq Template Switching Oligo (TSO)
iC-iG-iCACACTCTTTCCCTACACGACGCrGrGrG
iC denotes a iso-dC; iG denotes a iso-dG; rG denotes a riboguanine; HLPC purification
SCRB-seq SMART PCR Primer
/5Biosg/ACACTCTTTCCCTACACGACGC
/5Biosg/ denotes a 5’ biotin; HLPC purification
SCRB-seq custom N5 primer
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T*
* denotes a phosphorothioate bond; HLPC purification
Nextera N701 Primer
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG
HLPC purification
Nextera N702 Primer
CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGG
HLPC purification
Nextera N703 Primer
CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGG
HLPC purification
Nextera N704 Primer
CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGG
HLPC purification
Nextera N705 Primer
CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGG
HLPC purification
Nextera N706 Primer
CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGG
HLPC purification
Nextera N707 Primer
CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGG
HLPC purification
Nextera N708 Primer
CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGG
HLPC purification
Nextera N709 Primer
CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGCTCGG
HLPC purification
Nextera N710 Primer
CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGCTCGG
HLPC purification
Nextera N711 Primer
CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGCTCGG
HLPC purification
Nextera N712 Primer
CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGCTCGG
HLPC purification
SCRB-seq Custom Read 1 Primer
TCTTTCCCTACACGACGCTCTTCCGATCT
HLPC purification
tSCRB Barcoded Oligo-dT Primer Plate v3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTJ(7)N(9)T(30)VN
/5Biosg/ denotes a 5’ biotin; J denotes a nucleic acid part of the cellular barcode; N denotes a random nucleic acid part of the unique molecular identifier; V denotes A or C or G; IDT Ultramer Plate; Standard desalting
A1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAACTTGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCATCTGCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCACANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTGCTTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTGTTGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACACTGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACGAANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCACGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACAAGCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATGACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGCTCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
A12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTAAGGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAATGCGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAAGCGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCATATNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTATGCATGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGGACANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATCCACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGGTATANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACAGGCANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAATGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGCTTANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGCAAANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
B12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGAGACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTATACACCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTAACGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACAGAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAGAGCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATTTCCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCACAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAACCTANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGGATCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTCACTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGGGAANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGCATNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
C12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGAAGATNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACATCGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTCGTGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCATCGAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGATCTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGTCATNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTAAGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCGAAANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTTGTGCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTATCCGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTTCACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
D12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCATAGCANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTCAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTACCGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGTTCTGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACCATTCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCTCTTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGACACTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTATAGCCGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTTCGCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGTAACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGATAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAAGCCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
E12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTGGTANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAAGACTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGGGATNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAACGGTTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGCCTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACCATGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGAGGTTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCTGGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGATTCGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTTTGCGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCACACANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTTTGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
F12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTACGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCAACTCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAATCANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGTTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACGCTANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACGATCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTCGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCTACTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTGCAANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGTAGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGTAGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTTGGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
G12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTAGGAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H1
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGTGAAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H2
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTCCANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H3
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGCATGANNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H4
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTGTTCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H5
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGAAGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H6
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCTTCCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H7
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGTACCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H8
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAAAGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H9
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTACGCAACNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H10
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCGGTNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H11
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTTATCNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
H12
/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAAACGGNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
Cell sorter
Plate centrifuge
Plate sealing roller
Low temperature laboratory freezer (-80oC)
Laboratory freezer (-20oC) and refrigerator (4oC)
Microcentrifuge for 1.5 ml Eppendorf tubes
Microcentrifuge for 0.2 ml 8-Tube Strips
Magnetic separator for 96-well plates
PCR thermocyclers (the number of cyclers equals the number of plates to be processed in parallel)
Magnetic separator for 2 ml Eppendorf tubes
Bioanalyzer instrument
qPCR instrument
Illumina sequencer
Pipette set
Multichannel pipette set
1) Decontaminate all contact surfaces with RNaseZap.
2) Prepare 96-well low-binding plates for single-cell sorting by dispensing 10µl of Qiagen TCL buffer supplemented with 1% 2-mercaptoethanol per well. Seal the plates well with adhesive foil and store them at room temperature for up to one day.
(!) Do not store the plates for prolonged periods to avoid lysis evaporation.
3) Using large nozzle size (100μ) and single-cell purity mode, sort a single-cell of interest into each well of the PCR plate.
(!) Before sorting the population of interest, test the correct aiming of the machine. First sort 10-20 cells per well into few wells located on top and bottom of a sealed with transparent seal PCR plate. The droplets should be visible on the seal surface. Then sort 10-20 cells per well into few wells located on top and bottom of an empty PCR plate. The liquid droplet should be visible at the bottom of the PCR plate. Do not use smaller than 100μ nozzle to avoid unnecessary cell stress. The use of FACS for single-cell isolation allows for index sorting. Nevertheless, be conservative on the surface markers used for staining to avoid inducing gene expression changes.
4) Immediately after sorting, seal the plate with adhesive foil, spin it down for 30 seconds at 1000 rcf and snap-freeze it with dry ice. Transfer the plates for storage at -80oC freezer.
(!) The plates can be stored at -80oC for up to one year. Make sure the adhesive foil used can withstand this temperature without detaching.
5) Decontaminate all contact surfaces with RNaseZap.
6) Equilibrate the RNAClean XP beads at room temperature (~2300 ml per plate).
7) Prepare fresh 80% molecular grade ethanol (~40 ml per plate).
8) Thaw and keep the 5 x Maxima H- Buffer, Advantage dNTP Mix, SCRB-seq Template Switching Oligo and tSCRB Barcoded Oligo-dT Primer Plate v3 on ice.
9) Prepare the reverse transcription component 1 (RT c1) and dispense the required amount of it into each well of a 0.2 ml 8-tube strips with attached caps. See Table 1.
10) Prepare the reverse transcription component 3 (RT c3) and dispense the required amount of it into each well of a 0.2 ml 8-tube strips with attached caps. See Table 2.
11) Thaw a frozen PCR plate with single cells, vortex for 5 seconds and spin down for 30 seconds at 1000 rcf.
12) Vortex the RNAClean XP beads until fully resuspended. Dispense the beads in 25 ml reagent reservoir. Using a multichannel pipette, add 22 µl of RNAClean XP beads to each well of the single-cell plate and gently pipette 15 times to mix. Cover the plate to prevent contamination from dust and incubate for 10 minutes at room temperature.
(!) Cover the plate in a way to avoid contact between the plate and the cover. Potential contact can lead to cross-contamination. For example, the bottom of a big enough kitchen box can be used. Cover the plate whenever possible in the subsequent steps. Decontaminate the cover frequently with RNaseZap.
13) Place the plate one the magnetic separator and incubate until the solution is clear.
14) Without disturbing the ring of separated magnetic beads, aspirate and discard 20 µl of the supernatant.
15) Add 180 µl of 80% molecular grade ethanol to each well. If the beads are not collected in a compact ring, move the plate gently up and down the magnetic stand to collect them. Incubate for 30 seconds.
16) Without disturbing the ring of separated magnetic beads, remove the supernatant completely.
17) Add 180 µl of 80% molecular grade ethanol to each well and incubate for 30 seconds.
18) Without disturbing the ring of separated magnetic beads, remove the supernatant completely.
19) Remove any residual liquid droplets from the walls by gently tapping the magnetic stand with the plate on it to the bench surface. Aspirate the residual volume of liquid with 10 µl tips loaded on a multichannel pipette.
20) Remove the PCR plate from the magnetic stand. Using a multichannel pipette, add 2,8 μl of RT component 1 to each well of the single-cell plate and mix.
(!) Time-sensitive step. Be as fast as possible. Do not allow to beads to dry and cracks to appear in the bead ring. If the magnetic stand has opposing magnetic sides (as with Thermo Fisher AM10027), you might consider resuspending four but not eight wells at a time. Magnetic stands with non-opposing magnetic sides (such as DynaMag, Thermo Fisher 12027) are easier to process.
21) Using a multichannel pipette, add 1,2 μl of the respective barcoded primer from the stock 14 µM tSCRB Barcoded Oligo-dT Primer Plate v3 (corresponds to reverse transcription component 2; final reaction concentration 2,4 µM) to each well of the single-cell plate and mix.
(!) From now on, keep the plates on ice unless indicated otherwise.
(!) Before removing the transparent seal from the stock primer plate, spin the plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells. Be extremely careful when removing the transparent seal to avoid primer cross-contamination. In general, do not aliquot stock plates with primer for more than 20 single-cell plates. Immediately after use, reseal well the plate with transparent seal.
22) Seal the single-cell plate with adhesive foil. Incubate the plate on a thermal cycler using the following program: heated lid at 105oC, 3 minutes at 72oC, forever at 4oC.
(+) If you process more than one plate, this is a good moment to perform steps 11 and 12 with the next plate.
23) Spin the single-cell plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
24) Using a multichannel pipette, add 3 μl of reverse transcription component 3 (RT c3) to each well of the single-cell plate and mix.
25) Seal the single-cell plate with adhesive foil. Spin the single-cell plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
26) Incubate the plate on a thermal cycler using the following program: heated lid at 105oC, 90 minutes at 42oC, 15 minutes at 72oC, hold at 4oC.
27) Thaw and keep the KAPA HiFi HotStart ReadyMix and SCRB SMART PCR primer on ice.
(+) If you process more than one plate, you can use the incubation time to perform steps 13 – 26 with the next plate. The parallel processing of more than one plate requires multiple PCR cyclers.
28) Shortly before the incubation ends, prepare the PCR master mix. See Table 3.
29) Spin the single-cell plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
30) Dispense the necessary amount of PCR master mix in a 25 ml reagent reservoir.
31) Using a multichannel pipette, add 18 μl of PCR master to each well of the single-cell plate and mix.
32) Seal the single-cell plate with adhesive foil. Spin the single-cell plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
33) Incubate the plate on a thermal cycler using the following program: heated lid at 100oC, 3 minutes at 98oC, 18-20 cycles (20 seconds at 98oC, 30 seconds at 65oC, 6 minutes at 72oC), 5 minutes at 72oC, hold at 4oC.
(!) The number of cycles depends on the biology of the cells used. For example, naïve T cells normally require 20 cycles, while activated T cells require 18 cycles. If different timepoints are to be compared, it is best to affix the cycles to the highest necessary number. This should not affect the performance due to the use of unique molecular identifiers, which eliminate the introduction of anPCR bias. Following this incubation, there is a potential stopping point. The plates can be stored at 4oC for up to 3 days before purification.
34) Equilibrate the AMPure XP beads at room temperature (~1500 ml per plate).
35) Prepare fresh 80% molecular grade ethanol (~12 ml per plate).
36) Spin the single-cell plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
37) Collect barcoded single-cell transcriptomes from one plate into two 2.0 ml DNA LoBind Tubes (columns 1-6 into one tube, columns 7-12 into another tube).
(!) The protocol allows the processing of multiple plates in parallel. The only limiting factor is the number of tube spots on the magnetic separator.
38) Vortex the AMPure XP beads until fully resuspended. Add 870 µl of AMPure XP beads to each tube and gently pipette 15 times to mix. Close the tube to prevent contamination from dust and incubate for 10 minutes at room temperature.
39) Place the tubes one the magnetic separator and incubate until the solution is clear.
40) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
41) Add 2 ml of 80% molecular grade ethanol to each tube. Incubate for 30 seconds.
42) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
43) Add 2 ml of 80% molecular grade ethanol to each tube. Incubate for 30 seconds.
44) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
45) Remove any residual liquid droplets from the walls by gently tapping the magnetic stand with the tubes on it to the bench surface. Aspirate the residual volume of liquid using a 10 µl tip.
46) Keeping the lids open, allow the ethanol to evaporate from the tubes until the ring of separate magnetic beads loses its glossiness (about 10 minutes).
47) Remove the tubes from the magnetic separator and resuspend the beads from each tube in 30 μl molecular grade water.
48) Combine the content of the two tubes coming from one plate into a single tube and incubate for 2 minutes at room temperature.
49) Place the tube (tubes if processing more than one plate) one the magnetic separator and incubate until the solution is clear.
50) Without disturbing the ring of separated magnetic beads, transfer 55 μl of the supernatant into a well of a PCR plate.
51) Vortex the AMPure XP beads until fully resuspended. Add 33 µl of AMPure XP beads to each used well of the PCR plate and gently pipette 15 times to mix. Cover the plate to prevent contamination from dust and incubate for 5 minutes at room temperature.
52) Place the plate on the magnetic separator and incubate until the solution is clear.
53) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
54) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
55) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
56) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
57) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
58) Remove any residual liquid droplets from the walls by gently tapping the magnetic stand with the plate to the bench surface. Aspirate the residual volume of liquid using 10 µl tips.
59) Allow the ethanol to evaporate from the wells until the ring of separate magnetic beads loses its glossiness (about 2 minutes).
60) Remove the plate from the magnetic separator and resuspend the beads from each well in 10-30 μl molecular grade water. Incubate for 2 minutes at room temperature.
(!) The volume depends on the cell biology. Ultimately, the final concentration should be in the quantification range of the Bionalyzer High Sensitivity DNA Kit.
61) Place the plate on the magnetic separator and incubate until the solution is clear.
62) Without disturbing the ring of separated magnetic beads, transfer 9-28 μl of the supernatant into a 1.5 ml DNA LoBind Tube.
63) Run 1 μl of each elute on a Bionalyzer High Sensitivity chip for band quality control and quantification. See Figure 1.
(!) To run the assay follow the instructions from the manufacturer. Following this step, there is a potential stopping point. The amplified cDNA can be stored at -20oC for several months.
64) Thaw and keep the Tagment DNA Buffer (TD buffer), Amplicon Tagment Mix (ATM), Nextera PCR Master Mix (NPM), 10 μM SCRB-seq custom N5 primer and 10 μM Nextera P7 index primers on ice.
(!) The use Nextera XT N5 index primer is substituted with SCRB-seq custom N5 primer, which is used along with Nextera XT N7 index primer. As the SCRB-seq custom N5 primer is universal for all plates to be pooled during sequencing, the indexing is introduced with the use of different Nextera XT N7 primers (e.g. N701-N712).
(!) Perform steps 62 – 78 on ice if not stated otherwise.
65) Dilute 1 ng of amplicon from each single-cell plate to a volume of 5 μl in a well of a PCR plate.
66) Add 10 μl TD buffer to each used well of the PCR plate.
67) Add 5 μl ATM to each used well of the PCR plate.
68) Using a multichannel pipette set to 15 μl, gently mix the reaction 10 times.
69) Seal the PCR plate with transparent seal. Spin the plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
70) Incubate the plate on a thermal cycler using the following program: heated lid at 100oC, 5 minutes at 55oC, hold at 4oC.
71) Immediately after incubation, add 5 μl Neutralize Tagment Buffer (NT buffer) to each used well of the PCR plate and gently mix 10 times.
(!) As following the incubation the transposase is still active, it is critical to perform step 71 in timely manner.
72) Cover the plate to prevent dust contamination and incubate for 5 minutes at room temperature.
73) Add 15 μl NPM and 8 μl molecular grade water to each used well of the PCR plate.
74) Add 1 μl of the 10 μM SCRB-seq custom N5 primer to each used well of the PCR plate.
75) Add 1 μl of the respective indexing 10 μM Nextera P7 primer to each sample.
76) Using a multichannel pipette set to 30 μl, gently mix the reaction 10 times.
77) Seal the PCR plate with transparent seal. Spin the plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
78) Incubate the plate on a thermal cycler using the following program: heated lid at 100oC, 3 minutes at 72oC, 30 seconds at 95oC, 12 cycles (10 seconds at 95oC, 30 seconds at 55oC, 30 seconds at 72oC), 5 minutes at 72oC, hold at 10oC.
(!) Following this step, there is a potential stopping point. The plate can be left overnight in the thermal cycler or stored for up to two days at 4oC.
79) Equilibrate the AMPure XP beads at room temperature (~60 μl per sample).
80) Prepare fresh 80% molecular grade ethanol (~800 μl per sample).
81) Spin the plate for 30 seconds at 1000 rcf to collect the liquid at the bottom of the wells.
82) Vortex the AMPure XP beads until fully resuspended. Add 30 µl of AMPure XP beads to each used well of the PCR plate and gently pipette 15 times to mix. Cover the plate to prevent contamination from dust and incubate for 5 minutes at room temperature.
83) Place the plate on the magnetic separator and incubate until the solution is clear.
84) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
85) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
86) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
87) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
88) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
89) Remove any residual liquid droplets from the walls by gently tapping the magnetic stand with the plate to the bench surface. Aspirate the residual volume of liquid using 10 µl tips.
90) Allow the ethanol to evaporate from the wells until the ring of separate magnetic beads loses its glossiness (about 2 minutes).
91) Remove the plate from the magnetic separator and resuspend the beads from each well in 52 μl molecular grade water. Incubate for 2 minutes at room temperature.
92) Place the plate on the magnetic separator and incubate until the solution is clear.
93) Without disturbing the ring of separated magnetic beads, transfer 50 μl of the supernatant into a well of a new PCR plate.
94) Vortex the AMPure XP beads until fully resuspended. Add 30 µl of AMPure XP beads to each used well of the new PCR plate and gently pipette 15 times to mix. Cover the plate to prevent contamination from dust and incubate for 5 minutes at room temperature.
95) Place the plate on the magnetic separator and incubate until the solution is clear.
96) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
97) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
98) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
99) Add 180 µl of 80% molecular grade ethanol to each used well from the PCR plate. Incubate for 30 seconds.
100) Without disturbing the ring of separated magnetic beads, aspirate and discard the supernatant.
101) Remove any residual liquid droplets from the walls by gently tapping the magnetic stand with the plate to the bench surface. Aspirate the residual volume of liquid using 10 µl tips.
102) Allow the ethanol to evaporate from the wells until the ring of separate magnetic beads loses its glossiness (about 2 minutes).
103) Remove the plate from the magnetic separator and resuspend the beads from each well in 10 μl molecular grade water. Incubate for 2 minutes at room temperature.
104) Place the plate on the magnetic separator and incubate until the solution is clear.
105) Without disturbing the ring of separated magnetic beads, transfer 9 μl of the supernatant into a PCR tube.
106) Run 1 μl of each elute on a Bionalyzer High Sensitivity chip for band quality control. See Figure 2.
(!) To run the assay follow the instructions from the manufacturer. Following this step, there is a potential stopping point. The libraries can be stored at -20oC for several weeks. Bioanalyzer can not be used as a mean for library quantification. The library quantification and pooling must be performed based on the Illumina recommendations (SY-930-1010, Illumina) with the use of KAPA SYBR FAST qPCR Master Mix (KK4600, Kapa Biosystems).
Sequencing Recommendation:
Sequencing read 1 (SCRB-seq Custom Read 1 Primer): 16 bp
Index read 1 (Illumina HP12 primer): 8 bp
Sequencing read 2 (Illumina HP11 primer): 50 – 100 bp
* The Illumina HP10 read 1 primer must be replaced with SCRB-seq Custom Read 1 Primer. For replacement, follow the Illumina recommendations.
** Aim for 0.5 – 1 million reads per cell (48 – 96 million reads per 96-well single-cell plate)
1 Soumillon, M., Cacchiarelli, D., Semrau, S., van Oudenaarden, A. & Mikkelsen, T. S. Characterization of directed differentiation by high-throughput single-cell RNA-Seq. bioRxiv, 003236, doi:10.1101/003236 (2014).
2 Kanev, K. et al. Proliferation-competent Tcf1+ CD8 T cells in dysfunctional populations are CD4 T cell help independent. Proceedings of the National Academy of Sciences 116, 20070-20076, doi:10.1073/pnas.1902701116 (2019).
The work was supported by the European Research Council starting and consolidator grants (ProtecTC, and ToCCaTa) and from the German Research Foundation (SFB1054).
Due to technical limitations, Tables 1-3 can be found in the Supplementary Files section
tSCRB Barcoded Oligo-dT Primer Plate v3
Table 3
Table 1
Table 2
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version
