CrY2H-seq interactome screening

doi:10.1038/protex.2017.058

Method Article

CrY2H-seq interactome screening

https://doi.org/10.1038/protex.2017.058

This work is licensed under a CC BY 4.0 License

This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.

Version 1

posted

You are reading this latest protocol version

Knowledge from protein interactome mapping can greatly enhance how we interpret genomic and transcriptomic data. However interactome datasets are currently incomplete, limited by the throughput of existing technologies. Here we describe a massively-multiplexed yeast two-hybrid method, CrY2H-seq, for deep coverage interactome mapping. This protocol accompanies Wanamaker et al \(Nature Methods 2017); it was added to the manuscript after formal peer review, as an aid to users.

Biotechnology

yeast two-hybrid

protein-protein interaction

interactome

sequencing

The yeast two-hybrid (Y2H) assay is one of the most widely adopted methods for generating interactome data, and has contributed to identifying complexes regulating disease[1] and to improving interpretation of disease phenotypes arising from genomic or transcriptomic variation[2,3]. However, broad-scale Y2H data acquisition remains constrained by the cost and labor requirements of tracking interactions and of the iterative screening necessary to generate complete interactome maps[4]. As described in the associated publication, we have developed CrY2H-seq (Cre reporter-mediated yeast two-hybrid coupled with next-generation sequencing) to enable massively-multiplexed yeast two-hybrid screening of high complexity bait and prey libraries. CrY2H-seq uses Cre recombinase as a Y2H protein-protein interaction reporter that functions intracellularly to covalently and unidirectionally link interacting bait and prey plasmids via specialized loxP sites that flank the protein-coding sequences. The linked protein-coding sequences serve as interaction-identifying DNA molecules that enable massively-multiplexed screening coupled with next-generation DNA sequencing to detect protein-protein interactions. Thus, large-scale matrix screening can be carried out en masse and interactome data can rapidly be generated.

Strains (available through the Arabidopsis Biological Resource Center, https://abrc.osu.edu/)

• Y8800, prey strain

• CRY8930, bait strain

CrY2H-seq plasmids (available through the Arabidopsis Biological Resource Center, https://abrc.osu.edu/)

• pADlox prey vector

• pDBlox bait vector

Generating CrY2H-seq bait and prey clones

Entry clones to serve as your genes of interest

LR clonase (Life Technologies)

DH5α-T1^R chemically competent E. coli cells (Life Technologies)

SOC powder (MP Biomedicals)

Terrific Broth, granulated (Fisher)

Carbenicillin

Glycerol

Yeast transformation

Lithium Acetate dihydrate (Sigma)

Tris Base Ultrapure (US Biological)

EDTA Disodium Salt Dihydrate (US Biological)

Poly(ethylene glycol) 3350 (Sigma)

Salmon sperm DNA 10mg/mL (Sigma)

Yeast media

Agar (Fisher)

Dextrose (D-Glucose) anhydrous (Fisher)

Bacto Peptone (BD)

Bacto Yeast Extract (BD)

Drop-out mix synthetic minus leucine, histidine, tryptophan, adenine without yeast nitrogen base (US Biological)

Yeast nitrogen base without amino acids (Amresco)

Adenine hemisulfate salt (Sigma)

L-Histidine monohydrochloride monohydrate (Sigma)

L-Tryptophan (Sigma)

L-Leucine (Sigma)

Hygromycin B (Bioworld)

3-Amino-1,2,4-triazole (3-AT; Sigma)

PCR

Sodium phosphate monobasic (Fisher)

Sodium phosphate dibasic (Fisher)

Beta-mercaptoethanol (Calbiochem)

Zymolyase 20T (US Biological)

Betaine (Sigma)

Phusion HF DNA Polymerase (NEB)

Deoxynucleotides Set (BioPioneer)

DNA and sequencing library preparation

SeraMag Speedbeads (GE; 2% v./v. SeraMag Speedbeads, 18% w./v. PEG-8000, 1 M NaCl, 10 mM Tris HCl, 1mM EDTA)

QIAprep 96 turbo kit (Qiagen)

QIAquick gel extraction kit (Qiagen)

QIAquick PCR purification kit (Qiagen)

Illumina sequencing library preparation

End-It DNA End-Repair Kit (Epicentre-Illumina)

Klenow Fragment 3’-->5’ exo- (NEB)

TruSeq DNA Sample Prep Kit (Illumina)

T4 DNA ligase (NEB)

REAGENT SETUP

Terrific Broth + antibiotic Dissolve 47.6g to 1L of purified water. Then add 4mL glycerol to mixture and stir to dissolve completely. Autoclave for 15 minutes. Allow to cool to 50 °C and add 1 mL 1000x carbenicillin stock solution per liter terrific broth.

Carbenicillin (1,000x) stock Dissolve 50 mg carbenicillin disodium salt in a total volume of 1 mL deionized distilled water. Filter-sterilize and aliquot. Use at a working concentration of 50 mg/L. Store at −20 °C.

SOC Dissolve 31 g/L of purified water. Autoclave for 15 minutes.

0.5 M EDTA (pH 8.0) Dissolve 93.05 g EDTA (disodium salt, Dihydrate) in 400 mL deionized distilled water. Adjust pH to 8.0 using NaOH and bring the final volume up to 500 mL with deionized distilled water and autoclave.

1 M Tris (pH 7.5) Dissolve 121.14 g Tris base in 800 mL deionized distilled water. Adjust the pH to 7.5 using concentrated HCl and bring the volume up to 1 liter with deionized distilled water and autoclave.

10x Tris-EDTA (TE) buffer (pH 7.5) Mix 100 mL 1 M Tris (pH 7.5), 20 mL 0.5 M EDTA (pH 8.0) and 880 mL deionized distilled water. Autoclave.

50% Glycerol solution Dissolve 500 mL glycerol in a total of 1 L deionized distilled water and autoclave.

1 M Lithium Acetate Dissolve 10.2 g lithium acetate dihydrate in a total volume of 100 mL deionized distilled water and autoclave. Store at room temperature.

50% PEG solution (wt/vol) Dissolve 50 g PEG-3350 in a total volume of 100 mL deionized distilled water and autoclave.

Lithium Acetate/Tris EDTA solution Combine 1 mL 1 M lithium acetate solution, 1 mL 10x TE buffer (pH 7.5), and 8 mL sterile water.

Lithium Acetate/Tris EDTA/PEG solution Combine 1 mL 1 M lithium acetate solution, 1 mL 10x TE buffer (pH 7.5), and 8 mL of 50% PEG solution.

40% Glucose solution Dissolve 400 g D-glucose in up to 1 L deionized distilled water and autoclave.

40 mM Tryptophan solution Dissolve 817 mg of tryptophan in 100 mL deionized distilled water. Filter sterilize, protect from light, and store at 4 °C.

100 mM Histidine solution Dissolve 1.55 g histidine in 100 mL deionized distilled water. Filter sterilize, protect from light, and store at room temperature.

100 mM Leucine solution Dissolve 1.31 g leucine in 100 mL deionized distilled water. Filter sterilize or autoclave and store at room temperature.

1 M 3-AT solution Dissolve 8.4 g 3-AT in a total volume of 100 mL deionized distilled water. Filter-sterilize and aliquot as required. Store at −20 °C for up to 6 months.

YEPD media (liquid and solid) Dissolve 10 g yeast extract, 20 g peptone, and 200 mg adenine hemisulfate in a total of 950 mL deionized distilled water. Adjust the pH to 6.0 with HCl. If preparing solid medium, add 20 g agar (omit if preparing liquid) and autoclave. Add 50mL 40% glucose solution after autoclaving.

Synthetic complete dropout media (liquid and solid) Dissolve 6.7 g yeast nitrogen base, 1.47 g of dropout mix, and 200 mg adenine hemisulfate in 900 mL deionized distilled water. Adjust pH to 5.9 with sodium hydroxide. Add 20 g of agar for solid medium (omit if preparing liquid) and autoclave. Allow to cool to 50 °C, then add 50 mL 40% glucose solution, and 8 mL of each amino acid solution desired. If preparing 1 mM 3-AT medium, add 1 mL of 1 M 3-AT solution.

0.1 M Sodium phosphate buffer pH 7.4 Add 3.1 g of sodium phosphate monobasic and 10.9 g of sodium phosphate dibasic to up to 1 L deionized distilled water. The final pH solution will be 7.4.

Yeast lysis buffer Combine 0.1 M sodium phosphate buffer pH 7.4 with 1% betamercaptoethanol, 2.5mg/mL Zymolyase 20T and 100 ug/mL RNase A. Aliquot and store at -20 °C or make fresh.

0.2 μm pore vacuum filtration units for 250 mL total volume

0.2 μm pore syringe filters

10 mL syringes

96-well spectrophotometer

96-well clear flat bottom plates with 300 mL well capacity

96-well black flat bottom plates

96-well v-bottom plates with 400 mL well capacity

6-well culture plates

Disposable 100 mL reservoirs (Vistalab Technologies)

Vortex

Clinical centrifuge

Water bath

Rattler Plating Beads (5 mm; ZymoResearch)

Benchtop incubator (30 °C and 42 °C)

Shaking incubator (30 °C and 37 °C)

Microcentrifuge

Microcentrifuge tubes (1.5 mL or 2 mL)

Aluminum foil plate seals or automated plate sealer

PCR machine

96-well PCR plates

Petri dishes (100 mm and 150 mm)

Polypropylene centrifuge tubes (15 mL and 50 mL)

Microwave

Qubit fluorometric quantitation kit (Life Technologies)

dsDNA Quantifluor System (Promega)

Agarose gel electrophoresis system

High throughput Gateway LR cloning of entry clones into CrY2H-seq destination plasmids.

For recombining 96 entry clones, prepare the following master mix in one tube:
See figure in Figures section.

*pDEST vector DNA signifies pADlox plasmid or pDBlox plasmid.

One master mix and one 96-well PCR plate must be prepared for each plasmid.

Aliquot 4 μL into each well of a 96-well PCR plate.
Add 1 μL of each different entry clone to each well.
Seal plate very well and vortex briefly to mix. Centrifuge briefly.
Incubate at 25 °C overnight.

Bacterial transformation and plasmid preparation of CrY2H-seq LR recombined clones

Thaw DH5α-T1^R chemically competent E. coli cells on ice and aliquot 10 μL of cells into each well of a 96-well PCR plate. This typically amounts to a total of 1 mL of cells per 96-well plate.
Add 1 μL of LR recombination reaction to competent cells. Do not pipet up and down, but instead seal plate, gently tap plate on the benchtop a few times to mix, then quickly return 96-well plate to ice.
Incubate on ice for 25 minutes.
Heat shock cells at 42 °C for 30 seconds in a PCR machine.
Place cells on back on ice for 2 minutes.
Add 100 μL of SOC to each well and incubate at 37 °C for 1 hour.
Directly inoculate 100 μL of transformation mix into 1 mL of terrific broth supplemented with carbenicillin (50 mg/L) in a 96-well deepwell plate and grow overnight at 37 °C with shaking.
Prepare archival glycerol stock plate by combining 50 μL of 50% glycerol (sterilized) with 100 μL of culture. Mix well by pipetting up and down.
Seal with foil and freeze at -80 °C.
For remaining culture, centrifuge at 3000 rpm for 10 minutes, and discard media by aggressively inverting plate over a waste collection bin, then tapping the inverted plate a few times on a clean absorbent pad or paper towel.
For plasmid preparation, follow QIAprep 96 Turbo Miniprep Kit protocol.
Measure DNA concentrations using the dsDNA Quantifluor System (Promega) and the 96-well plate reader.

Yeast transformation of purified CrY2H-seq bait and prey clones

Streak out Y8800 and CRY8930 strains on YEPD and YEPD supplemented with hygromycin (125 mg/L) media respectively. Incubate at 30 °C for 48 hours to obtain isolated colonies.
For each strain, inoculate 20 mL of YEPD with at least 10 isolated colonies and incubate at 30 °C with shaking overnight.
Measure and record OD₆₀₀ which should be between 4.0 to 6.0. Dilute cells with YEPD to a final OD₆₀₀ of 0.1-0.2, aiming for 100 mL of YEPD per 96-well plate.
Incubate at 30 °C with shaking until the OD₆₀₀ reaches 0.6-0.8, and cells have undergone two doublings. This typically takes about 4 to 6 hours.
Boil salmon sperm DNA for 5 minutes and then place on ice until needed.
Pellet cells at 1500 rpm for 5 minutes, discard media and wash cells in 10 mL sterile water per 96-well plate.
Pellet cells at 1500 rpm for 5 minutes, and resuspend cells in 10 mL 1x LiAc/TE solution per 96-well plate.
Pellet cells at 1500 rpm for 5 minutes, and resuspend cells in 2 mL 1x LiAc/TE solution per 96-well plate.
Add 10 mL Lithium Acetate/Tris EDTA/PEG solution and 200 μL salmon sperm DNA per 96-well plate. Gently invert cells to mix. Add cells to a sterile trough and pipette 120 μL of cells per well in a 96-well v-bottom plate.
Pipette 10 μL of plasmid DNA into cell solution.
Seal plates very well with a plate sealer or with foil. Briefly vortex to mix plasmid DNA with cell solution and gently tap plate on benchtop.
Incubate plate at 42 °C for 1 hour in a benchtop incubator.
Pellet cells at 1500 rpm, and discard transformation mix by aggressively inverting plate over a waste collection bin then tapping the inverted plate a few times on a clean absorbent pad or paper towel.
Add 100 μL sterile water to each well to wash pellets.
Pellet cells at 1500 rpm, remove sterile water from each well by gently inverting plate over a waste collection bin.
Resuspend pellets in residual sterile water in each well and spot 5 μL of transformation on 1x SC –Leu media for bait strains or 1x SC –Trp media for prey strains.
Grow at 30 °C for 3 days.
Pick colonies into 200 μL per well of 1x SC –Leu or 1x SC –Trp liquid media and grow to saturation for 2 to 3 days with shaking at 30 °C.
Prepare archival glycerol stock plate by combining 50 μL of 50% glycerol (sterilized) with 100 μL of culture. Mix well by pipetting up and down.
Seal with foil and freeze at -80 °C.
With remaining yeast cultures, continue to pooling strains for generating CrY2H-seq bait and prey libraries

Pooling CrY2H-seq bait and prey strains for generating multiplexed bait and prey libraries

Combine 50 μL of each prey strain culture into a sterile trough. Do the same for bait strain cultures.
Prepare 1 mL aliquots of at least 3 OD₆₀₀, mix with 500 μL of 50% glycerol, and store at -80 °C.

CrY2H-seq screening of multiplexed bait and prey libraries

Grow Y8800 strain with empty pADlox in 10 mL 1x SC –TRP at 30 °C for 2 days with shaking prior to screening. This strain will be spiked into mate culture to for self-activating protein identification.
Thaw at least 20 OD₆₀₀ of each library and inoculate each into 200 mL YEPD liquid media. Grow for 1 hour at 30 °C with shaking.
Measure OD₆₀₀ of each library, combine 20 OD₆₀₀ of each library, pellet cells, and discard media.
Resuspend cells in 13.5 mL YEPD and aliquot 1.5 mL of mate culture across 1.5 6-well culture plates. Incubate at 30 °C shaking at 50 rpm for 4.5 hours.
Combine 1.5 mL aliquots back together in one 50 mL tube. Reserve a 10 μL aliquot for calculating mating efficiency.
Pellet mate culture and resuspend in 100 mL 1x SC –Leu/-Trp supplemented with 125 g/mL hygromycin to enrich for diploids and reduce background growth. Grow at 30 °C overnight shaking at 150 rpm.
For calculating mating efficiency, plate serial dilutions (1:1,000, 1:10,000) of 10 μL mate culture reserved aliquot on 1x SC –Leu, 1x SC –Trp, and 1x SC –Leu/-Trp. Incubate for 3 days at 30 °C and then count colonies to calculate mating efficiency.
Pellet cells at 1500 rpm for 5 minutes and wash cells with 1x SC.
Pellet cells at 1500 rpm for 5 minutes and resuspend in sterile water to a final concentration of 1 OD₆₀₀ per mL.
Plate 500 μL (0.5 OD₆₀₀) of cells per plate on 1x SC –Leu/-Trp/-His + 1 mM 3-AT (~48 plates) using plating beads and grow for 3 days at 30 °C.
Collect the cells from each plate by pipetting 3.5 mL deionized distilled water on to the plate, placing lid back on dish, and moving plate around in a circular motion on the benchtop so that all colonies become suspended. Remove lid, tilt plate to one side and pipette the collected cells across two wells of a 96-well deepwell plate. If 48 selection plates were used, all 96 wells should be used in the deepwell.
Seal plates very well and heat inactivate cells for 20 minutes in a 75 °C water bath. This step is to heat inactivate any proteins, particularly Cre recombinase, in the cells.
Pellet cells at 3000 rpm for 10 minutes at 4 °C. Discard supernatant by first inverting the plate over a waste collection bin, then by tapping the inverted plate a few times on a clean absorbent pad or paper towel.
Add 300 μL of yeast lysis buffer to each well and incubate at 37 °C for 1 hour at 50 rpm.
Carry out plasmid preparation following the QIAprep 96 Turbo Miniprep Kit protocol recommendations for purifying low-copy plasmids. Omit the use of P1 resuspension buffer since cells are already resuspended in yeast lysis buffer. Use double the volumes of buffers P2 and P3. Include wash step with buffer PB, and pre-heat buffer EB to 70 °C prior to eluting DNA from the QIAprep membrane.
Measure DNA concentrations using the dsDNA Quantifluor System (Promega) and the 96-well plate reader.

Amplifying Cre-recombined ORF products from yeast minipreps

Prepare the following master mix in one tube (x100 for 1 96-well plate):
See figure in Figures section.

Primer sequences:

AD primer: 5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC

DB primer: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG

Aliquot 23 μL of master mix into every well of a 96-well PCR plate on ice. To each well add 2 μL of yeast miniprep. Seal plate with adhesive aluminum foil. Place the PCR plate on a thermocycler and run the following program: Step 1: Denaturation at 98 °C for 2 minutes

Step 2: Denaturation at 98 °C for 10 seconds

Step 3: Annealing at 65 °C for 30 seconds

Step 4: Extension at 72 °C for 90 seconds

Repeat steps 2 through 4 for a total of 21 cycles

Step 5: Final extension at 72 °C for 7 minutes

Step 6: Hold at 10 °C

Load 5 μL of each PCR product on a 1% agarose 1x TAE gel and run at 100 V for 30-40 minutes. Products should appear as a DNA smear corresponding to the size range of expected Cre recombined products (~ 1 kb to greater than 4 kb).
Pool PCR reactions and concentrate DNA by performing a QIAquick column clean up or isopropanol precipitation.
Purify PCR products from primers by doing two rounds of purification with SeraMag Speedbeads at a 1:1 bead to DNA ratio. Typical yield is roughly 2 μg of amplicon DNA.

Illumina sequencing library preparation

Fragment amplicon DNA to 300 bp with a Covaris S2 sonicator.
Perform a QIAquick column clean up (Qiagen) or isopropanol precipitation to remove small fragments. Elute or resuspend in 34 μL EB.
Following manufacturer’s instructions (Epicentre-Illumina) , prepare end-repair reaction by combining 34 μL of DNA with 5 μL 10x End-it buffer, 5 μL 10 mM dNTP mix, 5 μL ATP, and 1 μL End-it enzyme mix. Mix gently, perform a quick spin, and incubate at 22 °C for 45 minutes.
Perform a QIAquick column clean up (Qiagen) or isopropanol precipitation to remove small fragments. Elute or resuspend in 32 μL EB.
Prepare a-tail reaction by combining 32 μL DNA with 5 μL Klenow buffer (NEB Buffer 2), 10 μL 1 mM dATP, and 3 μL Klenow Fragment 3’-->5’ exo- (NEB). Mix gently, perform a quick spin, and incubate at 37 °C for 30 minutes.
Perform a QIAquick column clean up or isopropanol precipitation to remove small fragments. Elute or resuspend in 38 μL EB.
Prepare adapter ligation reactions by combining 37.5 μL of DNA with 5 μL of 10x DNA ligase buffer with ATP (NEB), 5 μL Truseq DNA adapter index (Illumina), and 2.5 μL T4 DNA ligase (NEB). Mix gently, perform a quick spin, and incubate at 16 °C overnight.
Run ligation reaction out on a 2% agarose gel and excise between 400-600 bp.
Purify using a QIAquick gel extraction kit (Qiagen) and elute in 25 μL EB.
Amplify adapter-ligated DNA by combining 23.5 μL DNA with 0.5 μL Phusion polymerase (NEB), 10 μL 5xGC buffer (NEB), 10 μL 5 M Betaine, 1 μL dNTPs (10mM each), 5 μL Truseq multiplexing PCR primer cocktail (Illumina).
Place the PCR plate on a thermocycler and run the following program: Step 1: Denaturation at 98 °C for 2 minutes

Step 2: Denaturation at 98 °C for 10 seconds

Step 3: Annealing at 62 °C for 30 seconds

Step 4: Extension at 72 °C for 30 seconds

Repeat steps 2 through 4 for a total of 3 times

Step 5: Final extension at 72 °C for 5 minutes

Step 6: Hold at 10 °C

Purify PCR products from primers with SeraMag Speedbeads at a 1:1 bead to DNA ratio.
Quantify the purified amplified library using a Qubit fluorometric quantitation kit.

Next-generation sequencing

To identify both ORFs on either end of interaction identifying fragments, 100 bp paired-end reads are recommended and sequencing to about 40 million read depth should provide sufficient coverage for screens of 2000 x 2000 ORFs.

Processing of paired-end reads

A software pipeline to analysis the raw sequencing data is available in the Wanamaker et al. Nature Methods 2017 supplementary files. Below is a brief description of how the pipeline processes the raw data. Inputs to the pipeline are FASTQ files from one sequencing run.

Reads are mapped using Bowtie2-2.0.2 [5] local alignment with default settings to a custom genome composed of Arabidopsis TF coding sequences from TAIR10, the Saccharomyces cerevisiae genome, Gal4 AD and Gal4 DB domain sequences, and the empty CrY2H-seq plasmid sequences.
A quality filter is applied requiring reads to map with at least 30 matching bases, allowing a maximum of 2 mismatches, 2 insertions or deletions, and 2 bases of trimming from the beginning of the read.
Reads are then joined with their corresponding read pairs and included in the next analysis step only if both reads passed the first filter and mapped to Arabidopsis TF ORF sequences.
Clonal fragments are removed from read pairs if both reads in a fragment contained the same start positions.
Paired reads for which each of the mates aligned to a different ORF and showed the same strand orientation (Cre recombination occurs such that ORFs on pADlox and pDBlox plasmids become inverted in a 3’-to-3’ orientation) are included in further analysis.
A size filter is applied that requires the sum of the lengths of each read (start position of each read to the end of each ORF) and the lox region conform to the expected library size of 400-600bp.
Fragments mapping to ORF junction regions are totaled.

Wang, X. et al. Three-dimensional reconstruction of protein networks provides insight into human genetic disease. Nat. Biotechnol. 30, 159–164 (2012).
Hofree, M., Shen, J. P., Carter, H., Gross, A. & Ideker, T. Network-based stratification of tumor mutations. Nat. Methods 10, 1108–1115 (2013).
Jiang, Z., Dong, X. & Zhang, Z. Network-Based Comparative Analysis of Arabidopsis Immune Responses to Golovinomyces orontii and Botrytis cinerea Infections. Scientific reports 6, 19149 (2016).
Venkatesan, K. et al. An empirical framework for binary interactome mapping. Nat. Methods 6, 83–90 (2009).
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359 (2012).

The authors declare no competing financial interests.

Download PDF

Version 1

posted

You are reading this latest protocol version

CrY2H-seq interactome screening

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

References

Additional Declarations

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

CrY2H-seq interactome screening

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

References

Additional Declarations

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Manage Cookie Preferences