This is a protocol preprint. Preprints are preliminary reports that have not undergone peer review. They should not be considered conclusive, used to inform clinical practice, or referenced by the media as validated information.
Method Article
Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput
J Christopher Love
Koch Institute, Broad Institute, Ragon Institute
Corresponding Author
Alex Shalek
MIT, Broad Institute, Ragon Institute
Corresponding Author
License:
This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License
Single-cell RNA-seq can precisely resolve cellular states, but applying this method to low-input samples is challenging. Here, we present Seq-Well, a portable, low-cost platform for massively parallel single-cell RNA-seq. Barcoded mRNA capture beads and single cells are sealed in an array of subnanoliter wells using a semipermeable membrane, enabling efficient cell lysis and transcript capture. We characterize Seq-Well extensively and use it to profile thousands of primary human macrophages exposed to tuberculosis.
Keywords
high-throughput, single-cell RNA-Seq, microwells
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Figure 26
Figure 27
Figure 28
Figure 29
Figure 30
The emergence of single-cell genomics has empowered new strategies for identifying the cellular and molecular drivers of biological phenomena1–19. Patterns in genome-wide mRNA expression measured by single-cell RNA-seq (scRNA-seq) can be leveraged to uncover distinct cell types, states and circuits within cell populations and tissues1–5,9–13. To inform our understanding of healthy and diseased states and eventually guide precision diagnostics and therapeutics, we need broadly applicable methods that are easy to use and enable high-throughput studies of cellular phenotypes, particularly for low-input (≤104 cells) samples such as clinical specimens. Typically, scRNA-seq involves isolating and lysing individual cells, then independently reverse transcribing and amplifying their mRNA before generating barcoded libraries that are pooled for sequencing. Although manual picking2,5,8, FACS sorting1,3,4 or integrated microfluidic circuits7,9,10 can isolate single cells, these approaches are constrained in scale by cost, time and labor. Recently developed massively parallel methods assign unique barcodes to each cell’s mRNAs during reverse transcription, enabling ensemble processing while retaining single-cell resolution. These methods typically yield single-cell libraries of lower complexity, but higher throughput reduces the impact of the technical and intrinsic noise associated with each cell in analyses11,12. The most common approach relies on microfluidic devices to generate reverse-emulsion droplets that couple single cells with uniquely barcoded mRNA capture beads11,12. Droplet-based techniques, however, can have inefficiencies in encapsulation, introduce technical noise through differences in cell lysis time and require specialized equipment—limiting where, when and at what scale scRNA-seq can be performed.
One alternative to these techniques is to use arrays of subnanoliter wells loaded by gravity, which reduces the need for peripheral equipment, decreases dead volumes and facilitates parallelization. Cells and beads have been coconfined in nanowell arrays to perform targeted single-cell transcriptional profiling13, yet the absence of a seal significantly impairs capture efficiency and increases cross-contamination. Nanowells have also been combined with microfluidic channels that facilitate oil-based single-cell isolation via fluid exchange14. Nevertheless, this design limits buffer exchange and necessitates integrated temperature and pressure controllers, impacting ease of use and portability15. Semiporous-membrane-covered nanowells have been used to link pairs of specific transcripts from single cells16; however, this approach used many beads per well, precluding unique single-cell libraries, and transcript capture and sealing efficiency were not addressed.
To overcome these challenges, we developed Seq-Well, a simple, portable platform for massively parallel scRNA-seq. Seq-Well confines single cells and barcoded poly(dT) mRNA capture beads in a PDMS array of 86,000 subnanoliter wells. Wells accommodate only one bead, enabling single-bead loading efficiencies of 95%. A simplified cell-loading scheme in turn enables capture efficiencies of around 80%, with a dual occupancy rate that can be tuned by adjusting the number of cells loaded and visualized before processing.
Array Functionalization
- 200 proof ethanol (VWR Cat No. 89125-188)
- (3-Aminopropyl)triethoxysilane (APTES) (Sigma Cat No. A3648)
- Acetone (Avantor Product No. 2440-10)
- p-Phenylene Diisothiocyanate (PDITC) (Sigma Cat No. 258555-5G)
- Pyridine (Sigma Cat No. 270970-1L)
- Dimethylformamide (DMF) (Sigma Cat No. 227056-1L)
- Chitosan (Sigma Cat No. C3646-100G)
- Poly(L-glutamic) acid sodium solution (Sigma Cat No. P4761-100MG)
- 5 M NaCl (Sigma Cat No. S6546-1L)
- Sodium Carbonate (Sigma Cat No. S2127-500G)
Buffers
Bead Loading Buffer
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Pre-Lysis Buffer
- Guanidine Thiocyanate, mw 118.16 g/mol (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Complete Lysis
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Hybridization Buffer
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Wash Buffer
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Array Quenching Buffer
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
RT Reagents
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
- Maxima 5x RT Buffer/Maxima H-RT (Thermo Fisher Scientific Cat No. EPO0753)
- 20% Ficoll PM-400 (Sigma Cat No. F5415-50mL)
- 10 mM dNTPs (New England BioLabs Cat No. N0447L)
- RNAse Inhibitor (Thermo Fisher Scientific Cat No. AM2696)
- Template Switching Oligo (Order from IDT: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG)
PCR Reagents
- Exonuclease I (E. coli) (New England Biolabs Cat No. M0293S)
- IS PCR Primer (Order from IDT: AAGCAGTGGTATCAACGCAGAGT)
- KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems Cat No. KK-2602)
Nextera Reagents
- Nextera XT DNA Library Preparation Kit (96 samples) (Illumina FC-131-1096)
- P5-SMART PCR Hybrid Oligo (Order from IDT: AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC)
- Nextera N70X Oligo (Order from Illumina)
Sequencing Reagents
- Custom Read 1 Primer (Order From IDT: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC)
Device Manufacturing
- Dow Corning Sylgard 184 Silicone Encapsulant Clear 0.5 kg kit (Part No. 184 SIL ELAST KIT 0.5 PG)
- Protolabs Custom Array Molding Plates (CAD file link)
- 45 micron Silicon Master Wafer Size (Cad file link)
- Corning 72x25 Microscope Slides (Cat. No. 2947)
Operating Equipment
- Polycarbonate (PCTE) 0.01 micron 62x22 mm precut membranes, 100 count (Sterlitech Custom Order)
- mRNA Capture Beads (Chemgenes Cat No. MACOSKO-2011-10)
- Lifter Slips, 25x60mm (Electron Microscopy Science Cat No. 72186-60)
Membrane Preparation
- Place a pre-cut (22 x 66 mm) polycarbonate membrane onto a glass slide, carefully using a gloved finger and tweezers to separate the membrane and paper. Note 1: The orientation of the polycarbonate membranes is not important.
Note 2: Discard any membranes that have creases or other large-scale imperfections.
See figure in Figures section.
- Place membranes onto a shelf in the plasma cleaner. Note: Place membranes on bottom shelf to reduce risk of them flying after vacuum is removed.
See figure in Figures section.
Close the plasma cleaner door, and then turn on the main power and pump switch. To form a vacuum, ensure that the 3-way valve lever is at the 9:00 position as shown below.
See figure in Figures section.
- Allow vacuum to form for 2 minutes. Once the vacuum has formed, simultaneously turn the valve to 12:00 while turning the power to the Hi setting (shown below). Note: The plasma should be a bright pink. If not, adjust the air valve to increase or decrease the amount of oxygen you are letting into the chamber.
See figure in Figures section.
Treat membranes with plasma for 7 minutes.
See figure in Figures section.
Critical – After treatment, in the following order, turn the RF level valve from HIGH to OFF, then turn off the power followed by turning off the vacuum. Then slowly open the valve until you can barely hear air entering chamber (Approximate valve position shown below). Leave until the door opens (~5 min).
See figure in Figures section.
- Remove slides from plasma cleaner and transfer to a 4-well dish. Note 1: If membranes have slightly folded over, slowly flip the membrane back using needle nose tweezers.
Note 2: If membranes have blown off the slide entirely, repeat above procedure to ensure you know which side was exposed to plasma.
- Quickly pipet 5 mL of 1xPBS over the dry membrane, preventing the membrane from folding on itself. Pro-tip: gently hydrate one end of the membrane with a single drop so that it adheres to the slide before dispensing the entire volume.
See figure in Figures section.
Remove any air bubbles underneath the membrane using wafer forceps.
- Membranes are now functionalized and ready for use. Note 1: Membranes solvated with 1xPBS should be used within 48 hours.
Note 2: If transporting solvated membranes (e.g. between buildings), remove all but ~1 mL of PBS to prevent membranes from flipping within the dish.
Note 3: Alternatively, membranes can be solvated in 1xPBS, dried out, and stored for 4 weeks at room temperature. When ready to use membranes, they can be rehydrated with 1xPBS. This is helpful when traveling with membranes or when you want to run Seq-Well in a laboratory without access to a plasma cleaner.
Bead Loading
Aspirate storage solution and solvate array(s) with 5 mL of bead loading buffer (BLB; See Appendix B: Buffers Guide).
Place array(s) under vacuum with rotation (50 RPM) for 10-15 minutes to remove air bubbles in wells.
See figure in Figures section.
Aliquot ~110,000 beads from stock into a 1.5 mL tube and spin on a tabletop centrifuge for 10-15 seconds to form a pellet.
Aspirate storage buffer and wash beads once in 500 uL of BLB.
- Pellet beads, aspirate BLB, and resuspend beads in 200 uL of BLB. Note: For each array, it’s recommended to load 110,000 beads. For example, when running two arrays you would aliquot 220,000 beads, wash, and resuspend in 400 uL of BLB.
Before loading beads, thoroughly aspirate BLB from the dish containing the array(s), being careful not to aspirate or dry the PDMS surface of the array(s).
Use a 200 uL pipette to apply 200 uL containing 110,000 beads, in a drop-wise fashion, to the surface of each array (See image below and Bead Loading Diagrams).
See figure in Figures section.
Place the loaded array(s) onto a rotator for 10 minutes (75 RPM).
See figure in Figures section.
- Thoroughly wash array(s) to remove excess beads from the surface. For each wash: a. Position each array so that it sits in the center of the 4-well dish.
b. Dispense 500 uL of BLB in the upper right corner of each array and 500 uL in the bottom right corner of each array. Be careful not to directly pipette onto the microwells, as it can dislodge beads.
c. Using wafer forceps, push each array against the left side of the 4-well dish to create a capillary flow, which will help remove beads from the surface.
d. Aspirate the liquid, reposition each array, and repeat on the opposite side.
See figure in Figures section.
Repeat step 9 as necessary. Periodically examine the array(s) under microscope to verify that no loose beads are present on the surface, as this will interfere with membrane attachment.
Once excess beads have been removed from the surface, solvate each array with 5 mL of BLB and proceed to cell loading.
Notes:
- If continuing to cell loading immediately (i.e., within 1-5 hours), loaded arrays should be stored in 5 mL of BLB.
- Loaded arrays can be stored for up to 72 hours in Array Quenching Buffer (See Appendix B: Buffers Guide).
Bead Loading Diagram
See figure in Figures section.
Bead Washing Diagram
See figure in Figures section.
Cell Loading
Cell Loading (without imaging)
At this point, your array(s) should be loaded with beads and sitting in BLB.
Obtain a cell or tissue sample and prepare a single cell suspension using your preferred protocol.
While preparing your single cell suspension, aspirate the BLB from each array and soak it in 5 mL of RPMI + 10% FBS (RP-10) for 5 minutes.
After obtaining a single cell suspension, count cells using a hemocytometer and make a new solution of 10,000 cells in 200 uL of RP-10.
Aspirate the RP-10, center each array in well, and then load the cell loading solution in a dropwise fashion onto the surface of each array.
- Intermittently rock the array(s) in the x & y direction for 5 minutes. Note: To visualize membrane sealing or cell loading, pre-label cells with AF647- anti CD45 if leukocytes or another surface marker in AF647.
Wash array(s) 4x with 5 mL of PBS to remove FBS in media – this is critical to ensure successful membrane attachment.
Aspirate final PBS wash and replace with 5 mL of RPMI media (no FBS).
Cell Loading (with imaging)
When pre-imaging cells, cells should be loaded first as beads will obstruct view of many cells and bead autofluorescence can interfere with the signal.
Obtain a cell or tissue sample and prepare a single cell suspension using your preferred protocol.
Count cells using a hemocytometer and resuspend 10,000 cells in 200 uL of cold CellCover (Anacyte).
Incubate cells at 4C for 1 hour.
- After the cells have been fixed, perform antibody staining at 4C. Note: Some epitopes may no longer be available as a result of the fixation process.
- Wash cells twice with 1xPBS, resuspend in 200 uL of CellCover10 buffer (pH 10 + 10% FBS; See Appendix B: Buffers Guide), and place on ice. Note: CellCover != CellCover10.
Obtain empty functionalized array(s), aspirate storage solution and soak array(s) with 5 mL of CellCover10 buffer (See Appendix B: Buffers Guide).
Aspirate media and load fixed cells onto the array(s) in a dropwise format.
Gently rock the array(s) in the x & y direction for 5 minutes.
Wash array(s) twice with 5 mL of CellCover10 (pH 10 + 10% FBS), then solvate in 5 mL of CellCover (No FBS).
Place a lift slip on each array, then image with a microscope.
After imaging, wash each array in 5 mL of CellCover10 media.
- Immediately load beads using the bead loading protocol provided above. Note: In the protocol provided above, beads are washed and loaded in BLB. When loading cells first, replace BLB with CellCover10 for all steps. After beads are loaded and sufficiently washed, you will wash the array 4x with CellCover10 without FBS and solvate arrays in CellCover.
Proceed with membrane sealing.
Membrane Sealing
Gather the following materials before sealing the array(s):
See figure in Figures section.
- Array(s) loaded with beads and cells (See Bead/Cell Loading)
- Pre-treated membrane(s) (See Membrane Preparation)
- Wafer forceps
- Paper towels
- Agilent clamps
- Clean microscope slides
Use the wafer forceps to transfer the array from media to the lid of a 4-well dish, being careful to keep the array as close to horizontal as possible.
See figure in Figures section.
Use the wafer forceps to remove a pre-treated membrane from the 4-well dish.
Gently dab away moisture from the glass slide on the paper towel until the membrane does not spontaneously change position on the glass slide.
Carefully position the membrane on the center of the microscope slide, leaving a small (2-3 mm) membrane overhang beyond the edge of the slide.
See figure in Figures section.
Holding the membrane in your left hand, invert the microscope slide so that the treated surface is facing down.
Place the overhang of the membrane in contact with the PDMS surface of the array just above the boundary of the microwells.
See figure in Figures section.
Using your right hand, firmly hold down the overhang of the membrane against the PDMS surface of the array.
See figure in Figures section.
Critical Step: While maintaining pressure with your right hand to hold the membrane in place, gently apply the membrane.
See figure in Figures section.
Note 1: For optimal results, use little to no pressure while applying the membrane with the left hand. See Instructional Video (www.shaleklab.com/seqwell) for additional details.
Note 2: Attempts to manually seal the microwell device using pressure results in a ‘squeegee’ effect, effectively removing moisture from the membrane while fixing membrane creases in place.
After applying the membrane, carefully pry the array and membrane from the surface of the lid and transfer to an Agilent clamp.
See figure in Figures section.
Tighten clamp to the point of resistance and place in a 37C incubator for 30 minutes.
Repeat membrane sealing procedure if running multiple arrays.
Membrane Sealing Notes:
- Video tutorial of membrane sealing is available at the following link: www.shaleklab.com/seqwell
Cell Lysis and Hybridization
Remove the clamp from the incubator, and then remove the array(s) from the Agilent clamp(s).
Submerge each array, with top slide still attached, in 5 mL of pre-lysis buffer (See Appendix B: Buffers Guide).
- Gently rock the array(s) in pre-lysis buffer until the top glass slide lifts off. Note: Do not pry the top slide off as this can reverse membrane sealing. The time necessary for detachment of the top slide varies (10 seconds – 5 minutes). Just be patient.
- Once the top slide has detached, aspirate the pre-lysis buffer and add 5 mL of complete lysis buffer to each array. Note 1: Alternatively, 5 mL of complete lysis buffer can be prepared by adding 25 uL of 20% Sarkosyl and 50 uL of Beta-mercaptoethanol to pre-lysis buffer.
Note 2: Use a separate waste container for lysis buffer because guanidine thiocyanate can react with bleach in TC traps to create toxic gas.
Rotate the array(s) for 20 minutes at 50-60 rpm.
Remove the lysis buffer and wash each array with 5 mL of hybridization buffer.
Aspirate hybridization buffer and add another 5 mL of hybridization buffer to each array and rotate for 40 minutes at 50-60 rpm.
While array(s) are rocking in hybridization buffer, prepare RT master mix. (See Reverse Transcription and PCR).
Bead Removal
Aspirate hybridization buffer and replace with 5 mL of wash buffer.
Rock for 3 minutes.
Remove membrane with fine-tipped tweezers.
See figure in Figures section.
- Identify the orientation of a lifter slip so that the feet are facing upwards. Note: Orientation can be determined in two ways: (1) Shown below – the feet of the lift slip are not reflective, while the glass backing has a continuous reflection; (2) The feet can be palpated beneath your finger.
See figure in Figures section.
Place the lifter slip(s) in a separate 4-well dish with feet oriented upwards.
See figure in Figures section.
Carefully transfer each array to the new dish, inverting each array so that the PDMS surface is in contact with the feet of the lift slips.
See figure in Figures section.
Transfer 3 mL of wash buffer to each array in the new dish.
Precisely (+/- 2 grams) weigh the dish containing inverted array(s) to properly balance the centrifuge.
See figure in Figures section.
Spin for 5 minutes at 1000xg.
See figure in Figures section.
- After centrifugation, collect the beads and transfer them to a 15 mL conical tube for each array, if running multiple: a. Rinse the glass slide on the back of the array with wash buffer.
b. Invert the array and rinse the PDMS surface.
c. Lightly scrape the surface of the array to remove any retained beads using a microscope slide.
d. Remove array and rinse both sides of the lifter slips.
e. Collect suspended beads (10-12 mL) and transfer to a 15-mL conical tube.
Spin conical tube(s) for 5 minute at 1000xg.
Aspirate all liquid but 1 mL and transfer beads to a clean 1.5 mL centrifuge tube.
Rinse 15 mL conical with 500 uL of wash buffer and add to the 1.5 mL tube.
Reverse Transcription and PCR
Reverse Transcription (RT)
- Prepare the following Maxima RT Mastermix during the hybridization step: 80 uL H2O
40 uL Maxima 5x RT Buffer
40 uL 20% Ficoll PM-400
20 uL 10 mM dNTPs
5 uL RNase Inhibitor
5 uL 100 uM Template Switch Oligo
10 uL Maxima H-RT
Note 1: Add the Maxima H-RT enzyme immediately before adding to beads.
Note 2: The volumes provided above are good for one array.
After removing beads from the array(s), centrifuge them for 1 minute at 1000xg.
Remove supernatant and resuspend in 250 uL of 1xMaxima RT Buffer.
Centrifuge beads for 1 minute at 1000xg.
Aspirate 1xMaxima RT buffer and resuspend beads in 200 uL of the Maxima RT Mastermix.
Incubate at room temperature for 30 minute with end-over-end rotation.
After 30 minutes, incubate at 52C for 90 minutes with end-over-end rotation.
Following the RT reaction, wash beads once with 1 mL TE-TW, once with 1 mL TE-SDS, and twice with 1 mL of TE-TW.
TE-SDS
- 10 mM Tris pH 8.0 + 1 mM EDTA
- 0.5% SDS
TE-TW
- 10 mM Tris pH 8.0 + 1 mM EDTA
- 0.01% Tween-20
Note 1: Salts in the RT buffer can cause SDS to precipitate, making it difficult to remove in subsequent washes, so it is best to begin with a single wash in TE-TW.
STOP: This is a stopping point. Beads can be stored at 4C in TE-TW.
Exonuclease I Treatment
- Prepare the following Exonuclease I Mix:
20 uL 10X ExoI Buffer
170 uL H2O
10 uL ExoI
Centrifuge beads for 1 minute at 1000xg and aspirate the TE-TW solution.
Resuspend in 1 mL of 10 mM Tris pH 8.0.
Centrifuge beads again, remove supernatant and resuspend beads in 200 uL of Exonuclease I mix.
Incubate on heat block for 5 minutes at 37C and transfer to 37C incubator for 45 minutes with end-over-end rotation.
Wash the beads once with 1 mL of TE-SDS, then twice with 1 mL TE-TW.
STOP: This is a stopping point. Beads can be stored at 4C in TE-TW.
PCR (Whole Transcriptome Amplification (WTA))
- Prepare the following PCR Mastermix: 25 uL 2x KAPA HiFi Hotstart Readymix
14.6 uL H2O
0.4 uL 100 uM SMART PCR Primer
40 uL per reaction
Wash beads once with 1 mL of water, pellet beads, remove supernatant and resuspend in 500 uL of water.
- Mix well (do not vortex) to evenly resuspend beads and transfer 20 uL of beads to a separate 1.5 mL tube to count the beads. Note: Don’t vortex beads as this can result in bead fragmentation.
- Pellet the small aliquot of beads, aspirate the supernatant, and resuspend in 20 uL of bead counting solution (10% PEG, 2.5 M NaCl). Note: The bead counting solution aids in even dispersion of beads across a hemocytometer.
Count the beads using a hemocytometer.
Add 40 uL of PCR Mastermix per reaction to 96-well plate.
Add 1,500 – 2,000 beads per reaction in 10 uL of water for a total volume of 50 uL per PCR reaction making certain to PCR the entire array.
Use the following cycling conditions to perform whole-transcriptome amplification:
95C 3 minutes
4 Cycles:
98C 20 seconds
65C 45 seconds
72C 3 minutes
9 Cycles:
98C 20 seconds
67C 20 seconds
72C 3 minutes
Final Extension:
72 C 5 minutes
4 C Infinite hold
Note: The total number of PCR cycles necessary for amplification depends on the cell type used.
- 13 cycles is optimal for cell lines or larger cells (e.g. macrophages)
- 16 cycles is optimal for primary cells
Purification of PCR Products and analysis on the BioAnalyzer
Pull PCR products for your sample in a 1.5 mL microcentrifuge tube so that you have 14-16,000 beads/1.5 mL microcentrifuge tube
Purify PCR products using Ampure SPRI beads at 0.6x volumetric ratio.
- Resuspend your beads in a volume of water that is 10% of the starting volume. Note: For example, if you generate 24 PCR reactions (2,000 beads/reaction) for one array, you will collapse them into 3 pools (16,000 beads/pool), post PCR, in a volume of ~400 uL. After your DNA spri, you will elute in 40 uL of water.
- Run a BioAnalyzer High Sensitivity Chip according to the manufacturer’s instructions. Use 1 ul of the purified cDNA sample as input.
- Your WTA library should be fairly smooth, with an average bp size of 1-2 kbps.
Proceed to library preparation or store WTA product at 4C.
Library Preparation
Tagmentation of cDNA with Nextera XT
Make certain your thermocyclers are setup for tagmentation (step 5) & PCR (step 9).
- For each sample, combine 750 pg of purified cDNA with water in a total volume of 5 ul. It’s ideal to dilute your PCR product in a separate tube/plate so that you can add 5 uL of that for tagmentation. For Example: For 750 pg reactions, dilute PCR product to 150 pg/uL, then you can add 5 uL of this to a reaction tube for a 750 pg reaction.
To each tube, add 10 ul of Nextera TD buffer, then 5 uL of ATM buffer (the total volume of the reaction is now 20 ul).
Mix by pipetting ~5 times. Spin down.
Incubate at 55C for 5 minutes.
- Add 5 ul of Neutralization Buffer. Mix by pipetting ~5 times. Spin down for 1 minute at 1000xg. Bubbles are normal.
Incubate at room temperature for 5 minutes.
- Add to each PCR tube in the following order: 15 ul of Nextera PCR mix
8 ul H2O
1 ul of 10 uM P5-SMART PCR hybrid oligo
1 ul of 10uM Nextera N70X oligo
After sealing the reaction tubes and spinning them down (1 minute at 1000xg), run the following PCR program:
95C 30 sec
12 cycles of:
95C 10 seconds
55C 30 seconds
72C 30 seconds
Final Extension:
72C 5 minutes
4C Infinite hold
Purification of the Tagmented Library and Analysis on the BioAnalyzer
Purify tagmentation products using Ampure SPRI beads at 0.6x volumetric ratio.
Resuspend in 13 ul of H2O.
Run a BioAnalyzer High Sensitivity Chip according to the manufacturer’s instructions. Use 1 ul of the purified cDNA sample as input.
- Your tagmented library should be fairly smooth, with an average bp size of 650-750bp. Smaller-sized libraries will have more polyA reads; larger libraries may have lower sequence cluster density and cluster quality. Note: We have successfully sequenced libraries from 420-800 bps.
- Proceed to sequencing.
Sequencing
Once your sequencing library has passed the proper quality controls, you’re ready to proceed to sequencing. For a detailed loading protocol, please consult the Illumina website for a step-by-step manual. (https://support.illumina.com/training/online-courses/sequencing.html)
NextSeq500 – Shalek Lab Protocol
Make a 5 uL library pool at 4 nM as input for denaturation.
To this 5 uL library, add 5 uL of 0.2 N NaOH (make this solution fresh).
Flick to mix, then spin down and let tube sit for 5 minutes at room temperature.
After 5 minutes, add 5 uL of 0.2 M Tris-HCl pH 7.5.
Add 985 uL of HT1 Buffer to make a 1 mL, 20 pM library (solution 1).
In a new tube (solution 2), add 180 uL of solution 1 and dilute to 1.5 mL with HT1 buffer to make a 2.4 pM solution – this is the loading concentration you want to use.
Follow Illumina’s guide for loading a NextSeq500 Kit
Sequencing Specifications for the MiSeq or NextSeq:
Read 1: 20 bp
Read 2: 50 bp
Read 1 Index: 8 bp ← only necessary if you are multiplexing samples
Custom Read 1 primer
NextSeq 500:
MiSeq:
Appendix A: Array Synthesis
Day 0: Mounting Masters and Pouring Arrays
Combine Sylgard crosslinker with Sylgard base at a 1:10 ratio and mix vigorously for 10 minutes to create a PDMS master mix.
Once mixing is complete, put your PDMS master mix under vacuum for 15 minutes to remove any air bubbles.
Use a 10 mL syringe to inject 10 mL of PDMS master mix into molds with mounted PDMS masters.
Incubate at 70C for 2.5 hours.
Day 1: Array Functionalization Part 1
Note: For this section, make all solutions fresh!
Remove excess PDMS from edges of the glass slide.
See figure in Figures section.
Use scotch tape to remove excess PDMS from the surface of the array and the glass slide.
Place clean arrays into a metal slide basket.
See figure in Figures section.
Rinse arrays in 100% ethanol for 10 minutes.
See figure in Figures section.
Plasma treat arrays on high for 5 minutes.
Submerge arrays in 350 mL of 0.05% APTES in 95% ethanol for 10 minutes.
Spin dry arrays (500 RPM for 1 minute).
Incubate at RT for 10 minutes.
Submerge in 300 mL acetone in glass chamber and rock until all bubbles are out of the wells.
- Place in 350 mL 0.2% PDITC/10% pyridine/90% DMF solution in a glass chamber for 2 hours. Note: While this is rocking, prepare your Chitosan solution (See Appendix B).
See figure in Figures section.
Wash briefly in two different glass boxes of 300 mL DMF.
Dip and shake arrays in 300 mL of acetone.
Move to a fresh 350 mL of acetone and rock for 20 minutes.
Spin dry arrays (500 RPM for 1 minute).
Place arrays at 70C for 2 hours.
Remove from oven and let sit at room temperature for 20 minutes.
Submerge array in 350 mL of 0.2% chitosan solution (pH 6.5) and incubate at 37C for 1.5-2 hours.
Wash arrays 4x in separate 300 mL distilled water baths.
Submerge in 350 mL of 20 ug/mL poly(glutamic) acid, 2 M NaCl, and 100 mM sodium carbonate solution (pH 10.0)
- Place in vacuum chamber and apply house vacuum. Note: You should see bubbles form indicating solvation of wells.
Place vacuum chamber (still connected to house vacuum) on a rotator and let rotate overnight.
Day 2: Array Functionalization – Part 2
The following morning, remove arrays from vacuum and rotate at 50-60 rpm for 3 hours at room temperature.
- Place arrays at 4C and soak 24 hours before use. Note: Arrays can be stored in the poly(glutamic) acid solution for 6 weeks at 4C.
Appendix B: Buffers Guide
CellCover10
Reagents:
- CellCover (Anacyte Art. No. 800-125)
- FBS (Thermo Fisher Scientific Cat. No. 10437028)
- Sodium Carbonate (Sigma Cat. No. 223530-500G)
Working Concentrations:
- 10% FBS
- 100 mM Sodium Carbonate
Bead Loading Buffer:
Reagents:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- Water (Thermo Fisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
- 1.25 mL 2 M Sodium Carbonate
- Add 2.5 mL BSA (100 mg/mL)
- 21.25 mL H2O
- Titrate with glacial acetic acid to achieve a pH of 10.0 Working Concentrations:
- 100 mM Sodium Carbonate
- 10% BSA
Pre-Lysis Buffer:
Reagents:
- Guanidine Thiocyanate (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Quick Preparation Guide (500 mL):
- 1 mL 0.5 M EDTA
- Dissolve 295.4 grams in 500 mL of water Working Concentrations:
- 5 M Guanidine Thiocyanate
- 1 mM EDTA
Complete Lysis Buffer:
Reagents:
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Quick Preparation Guide (25 mL):
- 24.625 mL Pre-Lysis Buffer
- 125 uL 10% Sarkosyl
- 250 uL BME Working Concentrations:
- 5 M Guanidine Thiocyanate
- 1 mM EDTA
- 0.5% Sarkosyl
- 1% BME
Hybridization Buffer:
Reagents:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Quick Preparation Guide (25 mL):
- 10 mL 5 M NaCl
- 75 uL 1 M MgCl2
- 14.800 mL of PBS
- 125 uL Tween-20 Working Concentrations:
- 2 M NaCl
- 3 mM MgCl2
- 0.5% Tween-20
Wash Buffer:
Reagents:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
- 10 mL 5 M NaCl
- 75 uL 1 M MgCl2
- 500 uL 1 M Tris-HCl pH 8.0
- 14.3 mL water Working Concentrations:
- 2 M NaCl
- 3 mM MgCl2
- 20 mM Tris-HCl pH 8.0
Array Quenching Buffers:
Reagents:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
1.25 mL 2 M Sodium Carbonate- 250 uL 1 M Tris-HCl pH 8.0
- 23.5 mL water Working Concentrations:
- 100 mM Sodium Carbonate
- 10 mM Tris-HCl pH 8.0
0.2% Chitosan Solution:
Reagents:
- Chitosan (Sigma Cat No. C3646-100G)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide:
Dissolve 1 gram of Chitosan in 500 mL of DI waterAutoclave solution \(40 minutes sterilization, 20 minutes dry)Allow Chitosan solution to come to room temperature, then titrate with acetic acid to lower pH to 6.5Add 50 mL 5 M NaCl solution
Appendix C: Shopping List
Device Manufacturing:
Equipment:
- Dow Corning Sylgard 184 Silicone Encapsulant Clear 0.5 kg kit (Part No. 184 SIL ELAST KIT 0.5 PG)
- Protolabs Custom Array Molding Plates (CAD files available at www.shaleklab.com/seqwell)
- 45 micron Silicon Master Wafer Size (CAD files available at www.shaleklab.com/seqwell)
- Corning 72x25 Microscope Slides (Cat. No. 2947)
Array Functionalization:
Equipment:
- Plasma Oven (Harrick Plasma PDC-001-HP)
- 2x 30-slide rack slotted (VWR Cat No. 25461-014)
- 16x20 cm staining dish (VWR Cat No. 25461-018)
- Vacuum Desiccator (VWR Cat No. 24988-164)
- Sterile 4-well dishes (Thermo Scientific Cat No. 267061)
Reagents:
- 200 proof ethanol (VWR Cat No. 89125-188)
- (3-Aminopropyl)triethoxysilane (APTES) (Sigma Cat No. A3648)
- Acetone (Avantor Product No. 2440-10)
- p-Phenylene Diisothiocyanate (PDITC) (Sigma Cat No. 258555-5G)
- Pyridine (Sigma 270970-1L)
- Dimethylformamide (DMF) (Sigma Cat No. 227056-1L)
- Chitosan (Sigma Cat No. C3646-100G)
- Poly(L-glutamic) acid sodium solution (Sigma Cat No. P4761-100MG)
- 5M NaCl (Sigma Cat No. S6546-1L)
- Sodium Carbonate (Sigma Cat No. S2127-500G)
Buffer Reagents:
Bead Loading Buffer:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Pre-Lysis Buffer:
- Guanidine Thiocyanate (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Complete Lysis:
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Hybridization Buffer:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Wash Buffer:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Array Quenching Buffer:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
RT Reagents:
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
- Maxima 5x RT Buffer/Maxima H-RT (Thermo Fisher Scientific Cat No. EPO0753)
- 20% Ficoll PM-400 (Sigma Cat No. F5415-50mL)
- 10 mM dNTPs (New England BioLabs Cat No. N0447L)
- RNAse Inhibitor (Thermo Fisher Scientific Cat No. AM2696)
- Template Switching Oligo (Order from IDT)
PCR Reagents:
- Exonuclease I (E. coli) (New England Biolabs Cat No. M0293S)
- IS PCR Primer (Order from IDT)
- KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems Cat No. KK-2602)
Nextera Reagents:
- Nextera XT DNA Library Preparation Kit (96 samples) (Illumina FC-131-1096)
- P5-SMART PCR Hybrid Oligo (Order from IDT)
- Nextera N70X Oligo (Order from Illumina)
Operating Equipment:
- Polycarbonate (PCTE) 0.01 micron 62x22 mm precut membranes, 100 count (Sterlitech Custom Order)
- mRNA Capture Beads (Chemgenes Cat No. MACOSKO-2011-10)
- Lifter Slips, 25x60mm (Electron Microscopy Science Cat No. 72186-60)
- Shalek, A.K. et al. Nature 498, 236–240 (2013).
- Lohr, J.G. et al. Nat. Biotechnol. 32, 479–484 (2014).
- Shalek, A.K. et al. Nature 510, 363–369 (2014).
- Tirosh, I. et al. Science 352, 189–196 (2016).
- Hashimshony, T., Wagner, F., Sher, N. & Yanai, I. Cell Rep. 2, 666–673 (2012).
- Bendall, S.C. et al. Science 332, 687–696 (2011).
- Buenrostro, J.D. et al. Nature 523, 486–490 (2015).
- Smallwood, S.A. et al. Nat. Methods 11, 817–820 (2014).
- Zeisel, A. et al. Science 347, 1138–1142 (2015).
- Treutlein, B. et al. Nature 509, 371–375 (2014).
- Klein, A.M. et al. Cell 161, 1187–1201 (2015).
- Macosko, E.Z. et al. Cell 161, 1202–1214 (2015).
- Fan, H.C., Fu, G.K. & Fodor, S.P. Science 347, 1258367 (2015).
- Bose, S. et al. Genome Biol. 16, 120 (2015).
- Yuan, J. & Sims, P.A. Sci. Rep. 6, 33883 (2016).
- DeKosky, B.J. et al. Nat. Biotechnol. 31, 166–169 (2013).
- Ilicic, T. et al. Genome Biol. 17, 29 (2016).
- Yamanaka, Y.J. et al. Integr. Biol. (Camb.) 4, 1175–1184 (2012).
- Han, Q. et al. Proc. Natl. Acad. Sci. USA 109, 1607–1612 (2012).
We thank K. Shekhar, T. Tickle, and M. Xie for fruitful discussions. This work was supported by the Searle Scholars Program (A.K.S.), the Beckman Young Investigator Program (A.K.S.), NIH New Innovator Award DP2 OD020839 (A.K.S.), U24 AI11862-01 (A.K.S.), P50 HG006193 (A.K.S.), the Bill and Melinda Gates Foundation grant 03629000189 (A.K.S., J.C.L. and S.F.), the Ragon Institute (A.K.S. and S.F.), the Burroughs Wellcome Foundation (S.F.), P30 AI060354 (S.F.), DP3 DK09768101 (J.C.L.), P01 AI045757 (J.C.L.), R21 AI106025 (J.C.L.), R56 AI104274 (J.C.L.), the W.M. Keck Foundation (J.C.L.), and the US Army Research Office through the Institute for Soldier Nanotechnologies, under contract number W911NF-13-D-0001 (J.C.L.). This work was also supported in part by the Koch Institute Support (core) Grant P30-CA14051 from the National Cancer Institute. J.C.L. is a Camille Dreyfus Teacher–Scholar.
Version History
CURRENT STATUS: Posted
Version 1
Posted 14 Mar, 2017
Metrics
Comments: 0
HTML Views: ...
Associated Publications
Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput
by Todd M Gierahn, Marc H Wadsworth, Travis K Hughes, +6
Nature Methods (07 February, 2017)
Method Article
Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput
J Christopher Love
Koch Institute, Broad Institute, Ragon Institute
Corresponding Author
Alex Shalek
MIT, Broad Institute, Ragon Institute
Corresponding Author
Version History
CURRENT STATUS: Posted
Version 1
Posted 14 Mar, 2017
Metrics
Comments: 0
HTML Views: ...
License:
This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License
Single-cell RNA-seq can precisely resolve cellular states, but applying this method to low-input samples is challenging. Here, we present Seq-Well, a portable, low-cost platform for massively parallel single-cell RNA-seq. Barcoded mRNA capture beads and single cells are sealed in an array of subnanoliter wells using a semipermeable membrane, enabling efficient cell lysis and transcript capture. We characterize Seq-Well extensively and use it to profile thousands of primary human macrophages exposed to tuberculosis.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Figure 26
Figure 27
Figure 28
Figure 29
Figure 30
The emergence of single-cell genomics has empowered new strategies for identifying the cellular and molecular drivers of biological phenomena1–19. Patterns in genome-wide mRNA expression measured by single-cell RNA-seq (scRNA-seq) can be leveraged to uncover distinct cell types, states and circuits within cell populations and tissues1–5,9–13. To inform our understanding of healthy and diseased states and eventually guide precision diagnostics and therapeutics, we need broadly applicable methods that are easy to use and enable high-throughput studies of cellular phenotypes, particularly for low-input (≤104 cells) samples such as clinical specimens. Typically, scRNA-seq involves isolating and lysing individual cells, then independently reverse transcribing and amplifying their mRNA before generating barcoded libraries that are pooled for sequencing. Although manual picking2,5,8, FACS sorting1,3,4 or integrated microfluidic circuits7,9,10 can isolate single cells, these approaches are constrained in scale by cost, time and labor. Recently developed massively parallel methods assign unique barcodes to each cell’s mRNAs during reverse transcription, enabling ensemble processing while retaining single-cell resolution. These methods typically yield single-cell libraries of lower complexity, but higher throughput reduces the impact of the technical and intrinsic noise associated with each cell in analyses11,12. The most common approach relies on microfluidic devices to generate reverse-emulsion droplets that couple single cells with uniquely barcoded mRNA capture beads11,12. Droplet-based techniques, however, can have inefficiencies in encapsulation, introduce technical noise through differences in cell lysis time and require specialized equipment—limiting where, when and at what scale scRNA-seq can be performed.
One alternative to these techniques is to use arrays of subnanoliter wells loaded by gravity, which reduces the need for peripheral equipment, decreases dead volumes and facilitates parallelization. Cells and beads have been coconfined in nanowell arrays to perform targeted single-cell transcriptional profiling13, yet the absence of a seal significantly impairs capture efficiency and increases cross-contamination. Nanowells have also been combined with microfluidic channels that facilitate oil-based single-cell isolation via fluid exchange14. Nevertheless, this design limits buffer exchange and necessitates integrated temperature and pressure controllers, impacting ease of use and portability15. Semiporous-membrane-covered nanowells have been used to link pairs of specific transcripts from single cells16; however, this approach used many beads per well, precluding unique single-cell libraries, and transcript capture and sealing efficiency were not addressed.
To overcome these challenges, we developed Seq-Well, a simple, portable platform for massively parallel scRNA-seq. Seq-Well confines single cells and barcoded poly(dT) mRNA capture beads in a PDMS array of 86,000 subnanoliter wells. Wells accommodate only one bead, enabling single-bead loading efficiencies of 95%. A simplified cell-loading scheme in turn enables capture efficiencies of around 80%, with a dual occupancy rate that can be tuned by adjusting the number of cells loaded and visualized before processing.
Array Functionalization
- 200 proof ethanol (VWR Cat No. 89125-188)
- (3-Aminopropyl)triethoxysilane (APTES) (Sigma Cat No. A3648)
- Acetone (Avantor Product No. 2440-10)
- p-Phenylene Diisothiocyanate (PDITC) (Sigma Cat No. 258555-5G)
- Pyridine (Sigma Cat No. 270970-1L)
- Dimethylformamide (DMF) (Sigma Cat No. 227056-1L)
- Chitosan (Sigma Cat No. C3646-100G)
- Poly(L-glutamic) acid sodium solution (Sigma Cat No. P4761-100MG)
- 5 M NaCl (Sigma Cat No. S6546-1L)
- Sodium Carbonate (Sigma Cat No. S2127-500G)
Buffers
Bead Loading Buffer
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Pre-Lysis Buffer
- Guanidine Thiocyanate, mw 118.16 g/mol (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Complete Lysis
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Hybridization Buffer
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Wash Buffer
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Array Quenching Buffer
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
RT Reagents
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
- Maxima 5x RT Buffer/Maxima H-RT (Thermo Fisher Scientific Cat No. EPO0753)
- 20% Ficoll PM-400 (Sigma Cat No. F5415-50mL)
- 10 mM dNTPs (New England BioLabs Cat No. N0447L)
- RNAse Inhibitor (Thermo Fisher Scientific Cat No. AM2696)
- Template Switching Oligo (Order from IDT: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG)
PCR Reagents
- Exonuclease I (E. coli) (New England Biolabs Cat No. M0293S)
- IS PCR Primer (Order from IDT: AAGCAGTGGTATCAACGCAGAGT)
- KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems Cat No. KK-2602)
Nextera Reagents
- Nextera XT DNA Library Preparation Kit (96 samples) (Illumina FC-131-1096)
- P5-SMART PCR Hybrid Oligo (Order from IDT: AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC)
- Nextera N70X Oligo (Order from Illumina)
Sequencing Reagents
- Custom Read 1 Primer (Order From IDT: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC)
Device Manufacturing
- Dow Corning Sylgard 184 Silicone Encapsulant Clear 0.5 kg kit (Part No. 184 SIL ELAST KIT 0.5 PG)
- Protolabs Custom Array Molding Plates (CAD file link)
- 45 micron Silicon Master Wafer Size (Cad file link)
- Corning 72x25 Microscope Slides (Cat. No. 2947)
Operating Equipment
- Polycarbonate (PCTE) 0.01 micron 62x22 mm precut membranes, 100 count (Sterlitech Custom Order)
- mRNA Capture Beads (Chemgenes Cat No. MACOSKO-2011-10)
- Lifter Slips, 25x60mm (Electron Microscopy Science Cat No. 72186-60)
Membrane Preparation
- Place a pre-cut (22 x 66 mm) polycarbonate membrane onto a glass slide, carefully using a gloved finger and tweezers to separate the membrane and paper. Note 1: The orientation of the polycarbonate membranes is not important.
Note 2: Discard any membranes that have creases or other large-scale imperfections.
See figure in Figures section.
- Place membranes onto a shelf in the plasma cleaner. Note: Place membranes on bottom shelf to reduce risk of them flying after vacuum is removed.
See figure in Figures section.
Close the plasma cleaner door, and then turn on the main power and pump switch. To form a vacuum, ensure that the 3-way valve lever is at the 9:00 position as shown below.
See figure in Figures section.
- Allow vacuum to form for 2 minutes. Once the vacuum has formed, simultaneously turn the valve to 12:00 while turning the power to the Hi setting (shown below). Note: The plasma should be a bright pink. If not, adjust the air valve to increase or decrease the amount of oxygen you are letting into the chamber.
See figure in Figures section.
Treat membranes with plasma for 7 minutes.
See figure in Figures section.
Critical – After treatment, in the following order, turn the RF level valve from HIGH to OFF, then turn off the power followed by turning off the vacuum. Then slowly open the valve until you can barely hear air entering chamber (Approximate valve position shown below). Leave until the door opens (~5 min).
See figure in Figures section.
- Remove slides from plasma cleaner and transfer to a 4-well dish. Note 1: If membranes have slightly folded over, slowly flip the membrane back using needle nose tweezers.
Note 2: If membranes have blown off the slide entirely, repeat above procedure to ensure you know which side was exposed to plasma.
- Quickly pipet 5 mL of 1xPBS over the dry membrane, preventing the membrane from folding on itself. Pro-tip: gently hydrate one end of the membrane with a single drop so that it adheres to the slide before dispensing the entire volume.
See figure in Figures section.
Remove any air bubbles underneath the membrane using wafer forceps.
- Membranes are now functionalized and ready for use. Note 1: Membranes solvated with 1xPBS should be used within 48 hours.
Note 2: If transporting solvated membranes (e.g. between buildings), remove all but ~1 mL of PBS to prevent membranes from flipping within the dish.
Note 3: Alternatively, membranes can be solvated in 1xPBS, dried out, and stored for 4 weeks at room temperature. When ready to use membranes, they can be rehydrated with 1xPBS. This is helpful when traveling with membranes or when you want to run Seq-Well in a laboratory without access to a plasma cleaner.
Bead Loading
Aspirate storage solution and solvate array(s) with 5 mL of bead loading buffer (BLB; See Appendix B: Buffers Guide).
Place array(s) under vacuum with rotation (50 RPM) for 10-15 minutes to remove air bubbles in wells.
See figure in Figures section.
Aliquot ~110,000 beads from stock into a 1.5 mL tube and spin on a tabletop centrifuge for 10-15 seconds to form a pellet.
Aspirate storage buffer and wash beads once in 500 uL of BLB.
- Pellet beads, aspirate BLB, and resuspend beads in 200 uL of BLB. Note: For each array, it’s recommended to load 110,000 beads. For example, when running two arrays you would aliquot 220,000 beads, wash, and resuspend in 400 uL of BLB.
Before loading beads, thoroughly aspirate BLB from the dish containing the array(s), being careful not to aspirate or dry the PDMS surface of the array(s).
Use a 200 uL pipette to apply 200 uL containing 110,000 beads, in a drop-wise fashion, to the surface of each array (See image below and Bead Loading Diagrams).
See figure in Figures section.
Place the loaded array(s) onto a rotator for 10 minutes (75 RPM).
See figure in Figures section.
- Thoroughly wash array(s) to remove excess beads from the surface. For each wash: a. Position each array so that it sits in the center of the 4-well dish.
b. Dispense 500 uL of BLB in the upper right corner of each array and 500 uL in the bottom right corner of each array. Be careful not to directly pipette onto the microwells, as it can dislodge beads.
c. Using wafer forceps, push each array against the left side of the 4-well dish to create a capillary flow, which will help remove beads from the surface.
d. Aspirate the liquid, reposition each array, and repeat on the opposite side.
See figure in Figures section.
Repeat step 9 as necessary. Periodically examine the array(s) under microscope to verify that no loose beads are present on the surface, as this will interfere with membrane attachment.
Once excess beads have been removed from the surface, solvate each array with 5 mL of BLB and proceed to cell loading.
Notes:
- If continuing to cell loading immediately (i.e., within 1-5 hours), loaded arrays should be stored in 5 mL of BLB.
- Loaded arrays can be stored for up to 72 hours in Array Quenching Buffer (See Appendix B: Buffers Guide).
Bead Loading Diagram
See figure in Figures section.
Bead Washing Diagram
See figure in Figures section.
Cell Loading
Cell Loading (without imaging)
At this point, your array(s) should be loaded with beads and sitting in BLB.
Obtain a cell or tissue sample and prepare a single cell suspension using your preferred protocol.
While preparing your single cell suspension, aspirate the BLB from each array and soak it in 5 mL of RPMI + 10% FBS (RP-10) for 5 minutes.
After obtaining a single cell suspension, count cells using a hemocytometer and make a new solution of 10,000 cells in 200 uL of RP-10.
Aspirate the RP-10, center each array in well, and then load the cell loading solution in a dropwise fashion onto the surface of each array.
- Intermittently rock the array(s) in the x & y direction for 5 minutes. Note: To visualize membrane sealing or cell loading, pre-label cells with AF647- anti CD45 if leukocytes or another surface marker in AF647.
Wash array(s) 4x with 5 mL of PBS to remove FBS in media – this is critical to ensure successful membrane attachment.
Aspirate final PBS wash and replace with 5 mL of RPMI media (no FBS).
Cell Loading (with imaging)
When pre-imaging cells, cells should be loaded first as beads will obstruct view of many cells and bead autofluorescence can interfere with the signal.
Obtain a cell or tissue sample and prepare a single cell suspension using your preferred protocol.
Count cells using a hemocytometer and resuspend 10,000 cells in 200 uL of cold CellCover (Anacyte).
Incubate cells at 4C for 1 hour.
- After the cells have been fixed, perform antibody staining at 4C. Note: Some epitopes may no longer be available as a result of the fixation process.
- Wash cells twice with 1xPBS, resuspend in 200 uL of CellCover10 buffer (pH 10 + 10% FBS; See Appendix B: Buffers Guide), and place on ice. Note: CellCover != CellCover10.
Obtain empty functionalized array(s), aspirate storage solution and soak array(s) with 5 mL of CellCover10 buffer (See Appendix B: Buffers Guide).
Aspirate media and load fixed cells onto the array(s) in a dropwise format.
Gently rock the array(s) in the x & y direction for 5 minutes.
Wash array(s) twice with 5 mL of CellCover10 (pH 10 + 10% FBS), then solvate in 5 mL of CellCover (No FBS).
Place a lift slip on each array, then image with a microscope.
After imaging, wash each array in 5 mL of CellCover10 media.
- Immediately load beads using the bead loading protocol provided above. Note: In the protocol provided above, beads are washed and loaded in BLB. When loading cells first, replace BLB with CellCover10 for all steps. After beads are loaded and sufficiently washed, you will wash the array 4x with CellCover10 without FBS and solvate arrays in CellCover.
Proceed with membrane sealing.
Membrane Sealing
Gather the following materials before sealing the array(s):
See figure in Figures section.
- Array(s) loaded with beads and cells (See Bead/Cell Loading)
- Pre-treated membrane(s) (See Membrane Preparation)
- Wafer forceps
- Paper towels
- Agilent clamps
- Clean microscope slides
Use the wafer forceps to transfer the array from media to the lid of a 4-well dish, being careful to keep the array as close to horizontal as possible.
See figure in Figures section.
Use the wafer forceps to remove a pre-treated membrane from the 4-well dish.
Gently dab away moisture from the glass slide on the paper towel until the membrane does not spontaneously change position on the glass slide.
Carefully position the membrane on the center of the microscope slide, leaving a small (2-3 mm) membrane overhang beyond the edge of the slide.
See figure in Figures section.
Holding the membrane in your left hand, invert the microscope slide so that the treated surface is facing down.
Place the overhang of the membrane in contact with the PDMS surface of the array just above the boundary of the microwells.
See figure in Figures section.
Using your right hand, firmly hold down the overhang of the membrane against the PDMS surface of the array.
See figure in Figures section.
Critical Step: While maintaining pressure with your right hand to hold the membrane in place, gently apply the membrane.
See figure in Figures section.
Note 1: For optimal results, use little to no pressure while applying the membrane with the left hand. See Instructional Video (www.shaleklab.com/seqwell) for additional details.
Note 2: Attempts to manually seal the microwell device using pressure results in a ‘squeegee’ effect, effectively removing moisture from the membrane while fixing membrane creases in place.
After applying the membrane, carefully pry the array and membrane from the surface of the lid and transfer to an Agilent clamp.
See figure in Figures section.
Tighten clamp to the point of resistance and place in a 37C incubator for 30 minutes.
Repeat membrane sealing procedure if running multiple arrays.
Membrane Sealing Notes:
- Video tutorial of membrane sealing is available at the following link: www.shaleklab.com/seqwell
Cell Lysis and Hybridization
Remove the clamp from the incubator, and then remove the array(s) from the Agilent clamp(s).
Submerge each array, with top slide still attached, in 5 mL of pre-lysis buffer (See Appendix B: Buffers Guide).
- Gently rock the array(s) in pre-lysis buffer until the top glass slide lifts off. Note: Do not pry the top slide off as this can reverse membrane sealing. The time necessary for detachment of the top slide varies (10 seconds – 5 minutes). Just be patient.
- Once the top slide has detached, aspirate the pre-lysis buffer and add 5 mL of complete lysis buffer to each array. Note 1: Alternatively, 5 mL of complete lysis buffer can be prepared by adding 25 uL of 20% Sarkosyl and 50 uL of Beta-mercaptoethanol to pre-lysis buffer.
Note 2: Use a separate waste container for lysis buffer because guanidine thiocyanate can react with bleach in TC traps to create toxic gas.
Rotate the array(s) for 20 minutes at 50-60 rpm.
Remove the lysis buffer and wash each array with 5 mL of hybridization buffer.
Aspirate hybridization buffer and add another 5 mL of hybridization buffer to each array and rotate for 40 minutes at 50-60 rpm.
While array(s) are rocking in hybridization buffer, prepare RT master mix. (See Reverse Transcription and PCR).
Bead Removal
Aspirate hybridization buffer and replace with 5 mL of wash buffer.
Rock for 3 minutes.
Remove membrane with fine-tipped tweezers.
See figure in Figures section.
- Identify the orientation of a lifter slip so that the feet are facing upwards. Note: Orientation can be determined in two ways: (1) Shown below – the feet of the lift slip are not reflective, while the glass backing has a continuous reflection; (2) The feet can be palpated beneath your finger.
See figure in Figures section.
Place the lifter slip(s) in a separate 4-well dish with feet oriented upwards.
See figure in Figures section.
Carefully transfer each array to the new dish, inverting each array so that the PDMS surface is in contact with the feet of the lift slips.
See figure in Figures section.
Transfer 3 mL of wash buffer to each array in the new dish.
Precisely (+/- 2 grams) weigh the dish containing inverted array(s) to properly balance the centrifuge.
See figure in Figures section.
Spin for 5 minutes at 1000xg.
See figure in Figures section.
- After centrifugation, collect the beads and transfer them to a 15 mL conical tube for each array, if running multiple: a. Rinse the glass slide on the back of the array with wash buffer.
b. Invert the array and rinse the PDMS surface.
c. Lightly scrape the surface of the array to remove any retained beads using a microscope slide.
d. Remove array and rinse both sides of the lifter slips.
e. Collect suspended beads (10-12 mL) and transfer to a 15-mL conical tube.
Spin conical tube(s) for 5 minute at 1000xg.
Aspirate all liquid but 1 mL and transfer beads to a clean 1.5 mL centrifuge tube.
Rinse 15 mL conical with 500 uL of wash buffer and add to the 1.5 mL tube.
Reverse Transcription and PCR
Reverse Transcription (RT)
- Prepare the following Maxima RT Mastermix during the hybridization step: 80 uL H2O
40 uL Maxima 5x RT Buffer
40 uL 20% Ficoll PM-400
20 uL 10 mM dNTPs
5 uL RNase Inhibitor
5 uL 100 uM Template Switch Oligo
10 uL Maxima H-RT
Note 1: Add the Maxima H-RT enzyme immediately before adding to beads.
Note 2: The volumes provided above are good for one array.
After removing beads from the array(s), centrifuge them for 1 minute at 1000xg.
Remove supernatant and resuspend in 250 uL of 1xMaxima RT Buffer.
Centrifuge beads for 1 minute at 1000xg.
Aspirate 1xMaxima RT buffer and resuspend beads in 200 uL of the Maxima RT Mastermix.
Incubate at room temperature for 30 minute with end-over-end rotation.
After 30 minutes, incubate at 52C for 90 minutes with end-over-end rotation.
Following the RT reaction, wash beads once with 1 mL TE-TW, once with 1 mL TE-SDS, and twice with 1 mL of TE-TW.
TE-SDS
- 10 mM Tris pH 8.0 + 1 mM EDTA
- 0.5% SDS
TE-TW
- 10 mM Tris pH 8.0 + 1 mM EDTA
- 0.01% Tween-20
Note 1: Salts in the RT buffer can cause SDS to precipitate, making it difficult to remove in subsequent washes, so it is best to begin with a single wash in TE-TW.
STOP: This is a stopping point. Beads can be stored at 4C in TE-TW.
Exonuclease I Treatment
- Prepare the following Exonuclease I Mix:
20 uL 10X ExoI Buffer
170 uL H2O
10 uL ExoI
Centrifuge beads for 1 minute at 1000xg and aspirate the TE-TW solution.
Resuspend in 1 mL of 10 mM Tris pH 8.0.
Centrifuge beads again, remove supernatant and resuspend beads in 200 uL of Exonuclease I mix.
Incubate on heat block for 5 minutes at 37C and transfer to 37C incubator for 45 minutes with end-over-end rotation.
Wash the beads once with 1 mL of TE-SDS, then twice with 1 mL TE-TW.
STOP: This is a stopping point. Beads can be stored at 4C in TE-TW.
PCR (Whole Transcriptome Amplification (WTA))
- Prepare the following PCR Mastermix: 25 uL 2x KAPA HiFi Hotstart Readymix
14.6 uL H2O
0.4 uL 100 uM SMART PCR Primer
40 uL per reaction
Wash beads once with 1 mL of water, pellet beads, remove supernatant and resuspend in 500 uL of water.
- Mix well (do not vortex) to evenly resuspend beads and transfer 20 uL of beads to a separate 1.5 mL tube to count the beads. Note: Don’t vortex beads as this can result in bead fragmentation.
- Pellet the small aliquot of beads, aspirate the supernatant, and resuspend in 20 uL of bead counting solution (10% PEG, 2.5 M NaCl). Note: The bead counting solution aids in even dispersion of beads across a hemocytometer.
Count the beads using a hemocytometer.
Add 40 uL of PCR Mastermix per reaction to 96-well plate.
Add 1,500 – 2,000 beads per reaction in 10 uL of water for a total volume of 50 uL per PCR reaction making certain to PCR the entire array.
Use the following cycling conditions to perform whole-transcriptome amplification:
95C 3 minutes
4 Cycles:
98C 20 seconds
65C 45 seconds
72C 3 minutes
9 Cycles:
98C 20 seconds
67C 20 seconds
72C 3 minutes
Final Extension:
72 C 5 minutes
4 C Infinite hold
Note: The total number of PCR cycles necessary for amplification depends on the cell type used.
- 13 cycles is optimal for cell lines or larger cells (e.g. macrophages)
- 16 cycles is optimal for primary cells
Purification of PCR Products and analysis on the BioAnalyzer
Pull PCR products for your sample in a 1.5 mL microcentrifuge tube so that you have 14-16,000 beads/1.5 mL microcentrifuge tube
Purify PCR products using Ampure SPRI beads at 0.6x volumetric ratio.
- Resuspend your beads in a volume of water that is 10% of the starting volume. Note: For example, if you generate 24 PCR reactions (2,000 beads/reaction) for one array, you will collapse them into 3 pools (16,000 beads/pool), post PCR, in a volume of ~400 uL. After your DNA spri, you will elute in 40 uL of water.
- Run a BioAnalyzer High Sensitivity Chip according to the manufacturer’s instructions. Use 1 ul of the purified cDNA sample as input.
- Your WTA library should be fairly smooth, with an average bp size of 1-2 kbps.
Proceed to library preparation or store WTA product at 4C.
Library Preparation
Tagmentation of cDNA with Nextera XT
Make certain your thermocyclers are setup for tagmentation (step 5) & PCR (step 9).
- For each sample, combine 750 pg of purified cDNA with water in a total volume of 5 ul. It’s ideal to dilute your PCR product in a separate tube/plate so that you can add 5 uL of that for tagmentation. For Example: For 750 pg reactions, dilute PCR product to 150 pg/uL, then you can add 5 uL of this to a reaction tube for a 750 pg reaction.
To each tube, add 10 ul of Nextera TD buffer, then 5 uL of ATM buffer (the total volume of the reaction is now 20 ul).
Mix by pipetting ~5 times. Spin down.
Incubate at 55C for 5 minutes.
- Add 5 ul of Neutralization Buffer. Mix by pipetting ~5 times. Spin down for 1 minute at 1000xg. Bubbles are normal.
Incubate at room temperature for 5 minutes.
- Add to each PCR tube in the following order: 15 ul of Nextera PCR mix
8 ul H2O
1 ul of 10 uM P5-SMART PCR hybrid oligo
1 ul of 10uM Nextera N70X oligo
After sealing the reaction tubes and spinning them down (1 minute at 1000xg), run the following PCR program:
95C 30 sec
12 cycles of:
95C 10 seconds
55C 30 seconds
72C 30 seconds
Final Extension:
72C 5 minutes
4C Infinite hold
Purification of the Tagmented Library and Analysis on the BioAnalyzer
Purify tagmentation products using Ampure SPRI beads at 0.6x volumetric ratio.
Resuspend in 13 ul of H2O.
Run a BioAnalyzer High Sensitivity Chip according to the manufacturer’s instructions. Use 1 ul of the purified cDNA sample as input.
- Your tagmented library should be fairly smooth, with an average bp size of 650-750bp. Smaller-sized libraries will have more polyA reads; larger libraries may have lower sequence cluster density and cluster quality. Note: We have successfully sequenced libraries from 420-800 bps.
- Proceed to sequencing.
Sequencing
Once your sequencing library has passed the proper quality controls, you’re ready to proceed to sequencing. For a detailed loading protocol, please consult the Illumina website for a step-by-step manual. (https://support.illumina.com/training/online-courses/sequencing.html)
NextSeq500 – Shalek Lab Protocol
Make a 5 uL library pool at 4 nM as input for denaturation.
To this 5 uL library, add 5 uL of 0.2 N NaOH (make this solution fresh).
Flick to mix, then spin down and let tube sit for 5 minutes at room temperature.
After 5 minutes, add 5 uL of 0.2 M Tris-HCl pH 7.5.
Add 985 uL of HT1 Buffer to make a 1 mL, 20 pM library (solution 1).
In a new tube (solution 2), add 180 uL of solution 1 and dilute to 1.5 mL with HT1 buffer to make a 2.4 pM solution – this is the loading concentration you want to use.
Follow Illumina’s guide for loading a NextSeq500 Kit
Sequencing Specifications for the MiSeq or NextSeq:
Read 1: 20 bp
Read 2: 50 bp
Read 1 Index: 8 bp ← only necessary if you are multiplexing samples
Custom Read 1 primer
NextSeq 500:
MiSeq:
Appendix A: Array Synthesis
Day 0: Mounting Masters and Pouring Arrays
Combine Sylgard crosslinker with Sylgard base at a 1:10 ratio and mix vigorously for 10 minutes to create a PDMS master mix.
Once mixing is complete, put your PDMS master mix under vacuum for 15 minutes to remove any air bubbles.
Use a 10 mL syringe to inject 10 mL of PDMS master mix into molds with mounted PDMS masters.
Incubate at 70C for 2.5 hours.
Day 1: Array Functionalization Part 1
Note: For this section, make all solutions fresh!
Remove excess PDMS from edges of the glass slide.
See figure in Figures section.
Use scotch tape to remove excess PDMS from the surface of the array and the glass slide.
Place clean arrays into a metal slide basket.
See figure in Figures section.
Rinse arrays in 100% ethanol for 10 minutes.
See figure in Figures section.
Plasma treat arrays on high for 5 minutes.
Submerge arrays in 350 mL of 0.05% APTES in 95% ethanol for 10 minutes.
Spin dry arrays (500 RPM for 1 minute).
Incubate at RT for 10 minutes.
Submerge in 300 mL acetone in glass chamber and rock until all bubbles are out of the wells.
- Place in 350 mL 0.2% PDITC/10% pyridine/90% DMF solution in a glass chamber for 2 hours. Note: While this is rocking, prepare your Chitosan solution (See Appendix B).
See figure in Figures section.
Wash briefly in two different glass boxes of 300 mL DMF.
Dip and shake arrays in 300 mL of acetone.
Move to a fresh 350 mL of acetone and rock for 20 minutes.
Spin dry arrays (500 RPM for 1 minute).
Place arrays at 70C for 2 hours.
Remove from oven and let sit at room temperature for 20 minutes.
Submerge array in 350 mL of 0.2% chitosan solution (pH 6.5) and incubate at 37C for 1.5-2 hours.
Wash arrays 4x in separate 300 mL distilled water baths.
Submerge in 350 mL of 20 ug/mL poly(glutamic) acid, 2 M NaCl, and 100 mM sodium carbonate solution (pH 10.0)
- Place in vacuum chamber and apply house vacuum. Note: You should see bubbles form indicating solvation of wells.
Place vacuum chamber (still connected to house vacuum) on a rotator and let rotate overnight.
Day 2: Array Functionalization – Part 2
The following morning, remove arrays from vacuum and rotate at 50-60 rpm for 3 hours at room temperature.
- Place arrays at 4C and soak 24 hours before use. Note: Arrays can be stored in the poly(glutamic) acid solution for 6 weeks at 4C.
Appendix B: Buffers Guide
CellCover10
Reagents:
- CellCover (Anacyte Art. No. 800-125)
- FBS (Thermo Fisher Scientific Cat. No. 10437028)
- Sodium Carbonate (Sigma Cat. No. 223530-500G)
Working Concentrations:
- 10% FBS
- 100 mM Sodium Carbonate
Bead Loading Buffer:
Reagents:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- Water (Thermo Fisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
- 1.25 mL 2 M Sodium Carbonate
- Add 2.5 mL BSA (100 mg/mL)
- 21.25 mL H2O
- Titrate with glacial acetic acid to achieve a pH of 10.0 Working Concentrations:
- 100 mM Sodium Carbonate
- 10% BSA
Pre-Lysis Buffer:
Reagents:
- Guanidine Thiocyanate (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Quick Preparation Guide (500 mL):
- 1 mL 0.5 M EDTA
- Dissolve 295.4 grams in 500 mL of water Working Concentrations:
- 5 M Guanidine Thiocyanate
- 1 mM EDTA
Complete Lysis Buffer:
Reagents:
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Quick Preparation Guide (25 mL):
- 24.625 mL Pre-Lysis Buffer
- 125 uL 10% Sarkosyl
- 250 uL BME Working Concentrations:
- 5 M Guanidine Thiocyanate
- 1 mM EDTA
- 0.5% Sarkosyl
- 1% BME
Hybridization Buffer:
Reagents:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Quick Preparation Guide (25 mL):
- 10 mL 5 M NaCl
- 75 uL 1 M MgCl2
- 14.800 mL of PBS
- 125 uL Tween-20 Working Concentrations:
- 2 M NaCl
- 3 mM MgCl2
- 0.5% Tween-20
Wash Buffer:
Reagents:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
- 10 mL 5 M NaCl
- 75 uL 1 M MgCl2
- 500 uL 1 M Tris-HCl pH 8.0
- 14.3 mL water Working Concentrations:
- 2 M NaCl
- 3 mM MgCl2
- 20 mM Tris-HCl pH 8.0
Array Quenching Buffers:
Reagents:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide (25 mL):
1.25 mL 2 M Sodium Carbonate- 250 uL 1 M Tris-HCl pH 8.0
- 23.5 mL water Working Concentrations:
- 100 mM Sodium Carbonate
- 10 mM Tris-HCl pH 8.0
0.2% Chitosan Solution:
Reagents:
- Chitosan (Sigma Cat No. C3646-100G)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Quick Preparation Guide:
Dissolve 1 gram of Chitosan in 500 mL of DI waterAutoclave solution \(40 minutes sterilization, 20 minutes dry)Allow Chitosan solution to come to room temperature, then titrate with acetic acid to lower pH to 6.5Add 50 mL 5 M NaCl solution
Appendix C: Shopping List
Device Manufacturing:
Equipment:
- Dow Corning Sylgard 184 Silicone Encapsulant Clear 0.5 kg kit (Part No. 184 SIL ELAST KIT 0.5 PG)
- Protolabs Custom Array Molding Plates (CAD files available at www.shaleklab.com/seqwell)
- 45 micron Silicon Master Wafer Size (CAD files available at www.shaleklab.com/seqwell)
- Corning 72x25 Microscope Slides (Cat. No. 2947)
Array Functionalization:
Equipment:
- Plasma Oven (Harrick Plasma PDC-001-HP)
- 2x 30-slide rack slotted (VWR Cat No. 25461-014)
- 16x20 cm staining dish (VWR Cat No. 25461-018)
- Vacuum Desiccator (VWR Cat No. 24988-164)
- Sterile 4-well dishes (Thermo Scientific Cat No. 267061)
Reagents:
- 200 proof ethanol (VWR Cat No. 89125-188)
- (3-Aminopropyl)triethoxysilane (APTES) (Sigma Cat No. A3648)
- Acetone (Avantor Product No. 2440-10)
- p-Phenylene Diisothiocyanate (PDITC) (Sigma Cat No. 258555-5G)
- Pyridine (Sigma 270970-1L)
- Dimethylformamide (DMF) (Sigma Cat No. 227056-1L)
- Chitosan (Sigma Cat No. C3646-100G)
- Poly(L-glutamic) acid sodium solution (Sigma Cat No. P4761-100MG)
- 5M NaCl (Sigma Cat No. S6546-1L)
- Sodium Carbonate (Sigma Cat No. S2127-500G)
Buffer Reagents:
Bead Loading Buffer:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- BSA (Sigma Cat No. A9418-100G)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Pre-Lysis Buffer:
- Guanidine Thiocyanate (Sigma Cat No. AM9422)
- 0.5 M EDTA (Thermo Fisher Scientific Cat No. 15575020)
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
Complete Lysis:
- Pre-lysis buffer
- 10% Sarkosyl (Sigma Cat No. L7414)
- 100% 2-Mercaptoethanol (Cat No. NC0753648)
Hybridization Buffer:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1XPBS (Thermo Fisher Scientific Cat No. 10010023)
- Tween-20 (Fisher Scientific Cat No. BP337-100ML)
Wash Buffer:
- 5 M NaCl (Thermo Fisher Scientific Cat No. 24740011)
- 1 M MgCl2 (Sigma Cat No.63069-100ML)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
Array Quenching Buffer:
- Sodium Carbonate (Sigma Cat No. 223530-500G)
- 1 M Tris-HCl pH 8.0 (Thermo Fisher Scientific Cat No. 15568025)
- UltraPure Distilled Water (ThermoFisher Scientific Cat No. 10977023)
RT Reagents:
- UltraPure Distilled Water (Thermo Fisher Scientific Cat No. 10977023)
- Maxima 5x RT Buffer/Maxima H-RT (Thermo Fisher Scientific Cat No. EPO0753)
- 20% Ficoll PM-400 (Sigma Cat No. F5415-50mL)
- 10 mM dNTPs (New England BioLabs Cat No. N0447L)
- RNAse Inhibitor (Thermo Fisher Scientific Cat No. AM2696)
- Template Switching Oligo (Order from IDT)
PCR Reagents:
- Exonuclease I (E. coli) (New England Biolabs Cat No. M0293S)
- IS PCR Primer (Order from IDT)
- KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems Cat No. KK-2602)
Nextera Reagents:
- Nextera XT DNA Library Preparation Kit (96 samples) (Illumina FC-131-1096)
- P5-SMART PCR Hybrid Oligo (Order from IDT)
- Nextera N70X Oligo (Order from Illumina)
Operating Equipment:
- Polycarbonate (PCTE) 0.01 micron 62x22 mm precut membranes, 100 count (Sterlitech Custom Order)
- mRNA Capture Beads (Chemgenes Cat No. MACOSKO-2011-10)
- Lifter Slips, 25x60mm (Electron Microscopy Science Cat No. 72186-60)
- Shalek, A.K. et al. Nature 498, 236–240 (2013).
- Lohr, J.G. et al. Nat. Biotechnol. 32, 479–484 (2014).
- Shalek, A.K. et al. Nature 510, 363–369 (2014).
- Tirosh, I. et al. Science 352, 189–196 (2016).
- Hashimshony, T., Wagner, F., Sher, N. & Yanai, I. Cell Rep. 2, 666–673 (2012).
- Bendall, S.C. et al. Science 332, 687–696 (2011).
- Buenrostro, J.D. et al. Nature 523, 486–490 (2015).
- Smallwood, S.A. et al. Nat. Methods 11, 817–820 (2014).
- Zeisel, A. et al. Science 347, 1138–1142 (2015).
- Treutlein, B. et al. Nature 509, 371–375 (2014).
- Klein, A.M. et al. Cell 161, 1187–1201 (2015).
- Macosko, E.Z. et al. Cell 161, 1202–1214 (2015).
- Fan, H.C., Fu, G.K. & Fodor, S.P. Science 347, 1258367 (2015).
- Bose, S. et al. Genome Biol. 16, 120 (2015).
- Yuan, J. & Sims, P.A. Sci. Rep. 6, 33883 (2016).
- DeKosky, B.J. et al. Nat. Biotechnol. 31, 166–169 (2013).
- Ilicic, T. et al. Genome Biol. 17, 29 (2016).
- Yamanaka, Y.J. et al. Integr. Biol. (Camb.) 4, 1175–1184 (2012).
- Han, Q. et al. Proc. Natl. Acad. Sci. USA 109, 1607–1612 (2012).
We thank K. Shekhar, T. Tickle, and M. Xie for fruitful discussions. This work was supported by the Searle Scholars Program (A.K.S.), the Beckman Young Investigator Program (A.K.S.), NIH New Innovator Award DP2 OD020839 (A.K.S.), U24 AI11862-01 (A.K.S.), P50 HG006193 (A.K.S.), the Bill and Melinda Gates Foundation grant 03629000189 (A.K.S., J.C.L. and S.F.), the Ragon Institute (A.K.S. and S.F.), the Burroughs Wellcome Foundation (S.F.), P30 AI060354 (S.F.), DP3 DK09768101 (J.C.L.), P01 AI045757 (J.C.L.), R21 AI106025 (J.C.L.), R56 AI104274 (J.C.L.), the W.M. Keck Foundation (J.C.L.), and the US Army Research Office through the Institute for Soldier Nanotechnologies, under contract number W911NF-13-D-0001 (J.C.L.). This work was also supported in part by the Koch Institute Support (core) Grant P30-CA14051 from the National Cancer Institute. J.C.L. is a Camille Dreyfus Teacher–Scholar.
Associated Publications
Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput
by Todd M Gierahn, Marc H Wadsworth, Travis K Hughes, +6
Nature Methods (07 February, 2017)