Method Article
Massively multiplex single-cell Hi-C by combinatorial indexing
https://doi.org/10.1038/protex.2017.005
This work is licensed under a CC BY-NC 3.0 License
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version
Here, we present a protocol for carrying out single-cell combinatorial indexed Hi-C (sciHi-C). This protocol accompanies Ramani et al (Nature Methods, published online January 30, 2017; 10.1038/nmeth.4155); it was added to the manuscript after formal peer review, as an aid to users.
Primers
For barcodes used for cellular indexing see Supplementary File 1 of associated manuscript
Illumina F:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Barcoded Illumina R:
CAAGCAGAAGACGGCATACGAGAT[10 bp barcode]TGACTGGAGTTCAGACGTGTGCT
Buffers
1X Cell Lysis buffer
10 mM Tris-HCl pH8.0
10 mM NaCl
0.2% Igepal CA-630 (NP-40)
Autoclaved water
--- Store at 4°C
AMPure Buffer
20% PEG-8000
2.5M NaCl
--- Store at 4°C
2X B&W buffer
10 mM Tris-HCl pH8.0
1 mM EDTA
2 M NaCl
-- Store at RT
• NEBuffer 2 (NEB B7002S)
• NEBuffer 3.1 (NEB B7203S)
• 10% (wt/vol) UltraPure SDS (Life Tech 15553-027)
• DpnII (50U / uL, NEB R0543M)
• MseI (50U / uL, NEB R0525M)
• HaeIII (50U / uL, NEB R0108M)
• 100X BSA (NEB B9000S)
• RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531)
• Klenow Fragment (10 U/µL) (Thermo Scientific EP0052)
• Klenow Fragment (exo–) (5 U/µL) (Thermo Scientific EP0422)
• T4 DNA Polymerase (5 U/µL) (Thermo Scientific EP0062)
• T4 DNA Ligase (5 U/µL) (Thermo Scientific EL0012)
• T4 Polynucleotide Kinase (10 U/µL) (Thermo Scientific EK0032)
• 10X T4 DNA Ligase Buffer w/ ATP (NEB B0202S)
• Agencourt AMPure XP (Beckman Coulter A63880)
• 2X HotStart PCR ReadyMix (KAPA KK2601)
• Proteinase K (Thermo Scientific EO0492)
• FastDigest® BamHI (Thermo Scientific FERFD0504)
• Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001)
• dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181)
• Protease inhibitor cocktail (Roche 11873580001)
Standard lab equipment, including a centrifuge, ThermoMixer (Eppendorf or the like), ThermalCycler, & multichannel pipettes.
For the 5’GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Reagent Per reaction X96
10X NEBuffer 2 10 μl 10 μl x 96
5’-GATC Biotin Forward oligo (100 uM) 45 μl ~
Indexed Reverse oligo (100 uM) 45 μl ~
For the indexed Y-adaptors, set up the following reactions in 96-well plate format:
Reagent Per reaction X96
10X NEBuffer 2 10 μl 10 μl x 96
Barcoded Y-adaptor HI (100 uM) 20 μl ~
Barcoded Y-adaptor LO (100 uM) 20 μl ~
Water 50 uL 50 uL x 96
For both adaptors, heat to 98oC for 6 min, then ramp down (-0.1°C / s or slower) to RT. The final concentration of the 5’-GATC internal bridge adaptors is 45 uM. The final concentration of Y-adaptors is 20 uM
Check the annealing efficiency by running oligos on 4% DNA Agarose gel
2.2) Resuspend in 1 ml of ice-cold cell lysis buffer containing protease inhibitor cocktail (Roche).
2.3) Transfer 2.5E6 of each type of cell to separate tubes.
2.4) Centrifuge for 30 seconds at 800xg at RT.
2.5) Discard the supernatant and resuspend the pellet in each tube in 95 μl of water and 5 μl 10% SDS.
2.6) Incubate at 60°C for 10 min.
2.7) Add 100 μl of water and 25 μl 10% Triton X-100 to each tube and mix well.
2.8) Incubate at 37°C for 10 min.
2.9) Add 40 μl NEBuffer 3.1, 8 μl DpnII (10 U/ul) and 120 μl water to each tube, mix well.
2.10) Incubate at 37°C overnight.
2.11) Centrifuge for 60 seconds at 850xg at RT.
2.12) Discard the supernatant and resuspend the pellet in 384 μl water and 6 μl 100X BSA in each tube, mix well.
3.1) Distribute T4 DNA ligase/buffer to each well of one (or more) 96 well plates (below master mix volumes are for 2 plates, with 3 μl per well),
Reagents Per reaction
Water 380 (1.4x220) μl
50% PEG-4000 100 (0.5x220) μl
10X T4 DNA Ligase Buffer 220 (1x220) μl
T4 DNA ligase (5 U/ μl) 24 (0.15x220) μl
3.2) Distribute 2 uL of biotinylated barcoded double-stranded bridge adaptor (45 μM) to each well of each 96-well plate using a multi-channel pipette.
3.3) Distribute 5 μl nuclei to each well.
3.4) Incubate at 16°C overnight.
3.5) Distribute 1 μl 0.25 M EDTA to each well to inactivate ligation reaction.
3.6) On ice, pool the samples from each well together (1 ml) into two 1.5ml tubes.
3.7) Centrifuge at 850xg at RT for 90 seconds.
3.8) Resuspend in 291 μl of water, 6 μl 10%SDS, and 3 μl of 100X BSA, and combine the four tubes.
3.9) Centrifuge at 850xg at RT for 40 seconds.
3.10) Resuspend in 294 μl of water, 3 μl 10%SDS, and 3 μl of 100X BSA.
3.11) Incubate at 37°C for 3 min.
3.12) Centrifuge at 850xg at RT for 40 seconds.
3.13) Resuspend in 294 μl of water, 3 μl 10%SDS, and 3 μl of 100X BSA.
3.14) Centrifuge at 850xg at RT for 40 seconds.
3.15) Resuspend in 237 μl of water, and 3 μl of 100X BSA, mix well.
3.16) Add 5 μl 10% Triton X-100, mix well.
Nuclei 250 μl
10x T4 DNA Ligase buffer 30 μl
PNK (10 U/ μl) 20 μl
4.2) Incubate both at 37°C for 1 hr.
Water 615 μl
10x T4 DNA Ligase buffer 70 μl
T4 DNA ligase (5 U/ μl) 8 μl
100X BSA 7 μl
5.2) Mix well, and incubate at RT for 4 hr. Divide into two tubes.
5.3) Centrifuge at 850xg at RT for 90 seconds.
5.4) Resuspend in 294 μl of water, 3 μl 10%SDS, and 3 μl of 100x BSA.
5.5) Incubate at 37oC for 3 min.
5.6) Centrifuge at 850xg at RT for 40 seconds.
5.7) Resuspend in 294 μl of water, 3 μl 10%SDS, and 3 μl of 100x BSA.
5.8) Centrifuge at 850xg at RT for 40 seconds.
5.9) Resuspend in 294 μl of water, 3 μl 10%SDS, and 3 μl of 100x BSA.
6.2) Make the following master mix for reverse crosslinking:
Reagent Per plate (x110)
Water 15.5 μl (1705)
10% SDS 0.5 μl (55)
2X B&W Buffer 2 μl (220)
Proteinase K (20 mg / ml) 2 μl (220)
6.3) Distribute 20 μl to each well.
6.4) Incubate at 62°C overnight. Plates can then be stored at -20°C for later processing. At this point, 8-strip PCR tubes may be used for small-scale assays, and the remaining cells can be processed as a bulk control assay.
7.2) If the 96-well plate was stored at -20°C, thaw at 65°C for 10 min.
7.3) Add 40 μl water to each well.
7.4) Add 80 μl diluted AMPure beads to each well with 12-channel multipipette. Mix well.
7.5) Incubate at RT for 10 min.
7.6) Perform quick spin to bring volume to bottom of each well.
7.7) Place the plate in a 96-well magnet and discard the supernatant with multichannel pipette.
7.8) Wash two times with 160 μl 80% EtOH
7.9) Remove the residue solution.
7.10) Quick spin plate to get the beads to the bottom of each well.
7.11) Resuspend the beads in 5 μl water, mix well by moving the beads around on the magnet.
7.12) Incubate at 37°C for 10 min.
7.13) Quick spin to get the beads to the bottom of each well.
Reagent Per plate (x110)
Water 3.4 μl (374)
10X NEBuffer 2 1 μl (110)
MseI (10 U / μl) 0.3 μl (33)
HaeIII (10 U / μl) 0.3 μl (33)
8.2) Quickly spin plate to bring volume to bottom of each well.
8.3) Incubate at 37 °C for 20 h, 65°C for 30 min, and 4°C forever.
9.1) On ice, add 5 uL of the following reaction mix to each well:
Reagent Per plate (x110)
Water 3.55 μl (391.5)
10X NEBuffer 2 0.5 μl (55)
10 mM dNTPs 0.2 μl (22)
Klenow (10 U / μl) 0.15 μl (16.5)
Carrier plasmid DNA (220 ng/ul) 0.6 μl (60)
9.2) Quick spin plate.
9.3) Incubate at 18°C for 10 min, 65°C for 30 min., and 4°C forever.
Reagent Per reaction (x110)
10X NEBuffer 2 0.5 μl (55)
20 mM dATP 1 μl (110)
Klenow (exo-) (5 U/ μl) 0.3 μl (33)
Water 3.2 μl (352)
10.2) Quick spin.
10.3) Incubate at 37°C for 45 min, 65°C for 30 min., and 4°C forever.
Reagent Per reaction (x110)
Water 10.8 μl (1188)
10X T4 DNA Ligase Buffer 4 μl (440)
50% PEG-4000 4 μl (440)
T4 DNA ligase (5 U/ μl) 0.2 μl (22)
11.2) Distribute 1 μl Indexed sequencing adaptor (20 μM) to each well.
11.3) Quick spin.
11.4) Incubate at 16°C for 20 h, 70°C for 10 min, and 4°C forever
12.2) Use 100 μl EB to rinse each well and add to each respective tube.
12.3) Add 40 μl 3M NaOAc, 4 μl GlycoBlue, and 500 μl isopropanol to each tube, mix well.
12.4) Incubate tubes at -80oC for 2 h.
12.5) Spin at max speed on a chilled tabletop centrifuge for 30 min.
12.6) Resuspend and combine all 12 pellets in 100 μl EB.
12.7) Use 100 μl EB to rinse each tube twice (final volume 300 uL EB).
12.8) Add 100 μl AMPure Beads and 200 μl AMPure buffer.
12.9) Incubate at RT for 5 min.
12.10) Wash two times with 80% EtOH.
12.11) Resuspend in 100 μl water in each tube.
12.12) Bind to 10 μl M-280 Beads in 200 μl 1X B&W buffer
12.13) Incubate at RT for 20 min.
12.14) Wash 4 times with 200 μl 1X B&W buffer containing 0.1% Tween-20.
12.15) Wash twice with 200 μl EB.
12.16) Resuspend in 30 μl EB in each tube.
Water 22 µl
2X KAPA Hi-Fi Master Mix 40 μl
Illumina F (10 uM) 4 μl
Barcoded Illumina R (10 uM) 4 µl
Beads 10 µl
13.2) Carry out PCR amplification:
98 °C, 2 min;
4 cycles: 98°C, 20s; 60°C, 30s; 72oC, 45 sec
14-16 cycles: 98°C, 20s; 65°C, 20s; 72°C, 40 sec
13.3) Pool together all samples from each PCR reaction.
13.4) Add 30 μl AMPure beads and a volume of AMPure buffer necessary to achieve a 1:1 volumetric ratio of AMPure buffer + beads to sample.
13.5) Incubate 5 min at RT, and wash once with 0.6 ml 80% EtOH.
13.6) Resuspend in 200 μl water, add 155 μl AMPure buffer, mix well.
13.7) Incubate 5 min at RT, wash twice with 0.8 ml 80% EtOH.
13.8) Repeat 13.6 – 13.7 three times.
13.9) After final purification, elute DNA with 30 μl EB and measure concentration using a Qubit.
13.10) Proceed to sequencing on a HiSeq 2500 instrument (PE 2x250 bp reads).
Reagent Experimental Control
10X Cutsmart Buffer 1µl 1µl
PCR Product 1-2 µl (20 ng) 1-2 µl (20 ng)
EcoRI-HF 1 µl 0 µl
Water to 10 µl to 10 µl
14.2) Incubate at 37°C for 1 hr.
14.3) Run the entire volume of the reaction on a 6% TBE-PAGE gel. Digested libraries should demonstrate a marked shift, as properly ligated molecules will be cut with EcoRI.
~7 days
None
Protocol PDF PDF of the protocol
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version