Nicking Mutagenesis: comprehensive single-site saturation mutagenesis

doi:10.1038/protex.2016.061

Method Article

Nicking Mutagenesis: comprehensive single-site saturation mutagenesis

https://doi.org/10.1038/protex.2016.061

This work is licensed under a CC BY-NC 3.0 License

This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.

Version 1

posted

You are reading this latest protocol version

The purpose of this method is to generate comprehensive single-site saturation mutagenesis libraries. The required input for Nicking Mutagenesis is double-stranded plasmid DNA, and any plasmid dsDNA can be used provided that it contains a 7-base pair BbvCI recognition site. The method works by first creating an ssDNA template using a site and strand specific nicking endonuclease (Nt.BbvCI) followed by exonuclease digestion of the nicked strand. After creation of a heteroduplex by thermal cycling template with mutagenic oligos, the parental template ssDNA is destroyed by employing the opposite strand nicking endonuclease (Nb.BbvCI) followed by exonuclease digestion. A schematic of the method is outlined in Figure 1. The protocol can be completed in a single day (with transformation) and libraries can be harvested the following day.

Computational biology and bioinformatics

saturation mutagenesis

comprehensive saturation mutagenesis

high-throughput mutagenesis

protein engineering

protein library

Notes:

Plasmid dsDNA should be prepared fresh (<1 month old, avoid freeze/thaw) from a dam+ E. coli strain (i.e. XL1-Blue), and should be at a concentration sufficient to add 0.76 pmol dsDNA in ≤15 μL. Quality of the input dsDNA substrate is important. Mutagenic oligos are designed using the Agilent QuikChange Primer Design Program (www.agilent.com).

Troubleshooting/learning Nicking Mutagenesis:

Green/white fluorescent screening can be used to troubleshoot or learn the method. Plasmid pEDA5_GFPmut3_Y66H contains a constitutively expressed non-fluorescent GFPmut3 variant with a mutated chromophore (Gly65-Tyr66-Gly67 to Gly65-His66-Gly67). A single mutagenic oligo, GFP_H66Y, encodes the restore-to-function mutation resulting in fluorescent ‘mutants’. This plasmid can be obtained freely from Addgene (www.addgene.com, #80085). The protocol can be followed as below with the following adjustments:

20 μL of 10 μM GFP_H66Y primer is added to the phosphorylation reaction (single primer as opposed to a primer mix).
The secondary primer used is pED_2ND (primer sequences listed at end of protocol).
Prepare serial dilution plates of the transformation to calculate transformation and mutational efficiency.

Green/White Screening Primer Sequences:

GFP_H66Y: gcaaagcattgaacaccataaccgaaagtagtgacaagt

pED_2ND: ggtgattcattctgctaa

Reagents:

Nuclease-Free H₂O (NFH₂O, IDT)

Plasmid dsDNA (see notes above on preparation)

Mutagenic and secondary primers

T4 Polynucleotide Kinase Buffer (NEB)

10 mM ATP

10X CutSmart Buffer (NEB)

5X Phusion HF Buffer (NEB)

10 mM ATP

50 mM DTT

50 mM NAD⁺

10 mM dNTPs

Enzymes (all purchased from NEB; diluent for all enzymes is 1X NEB CutSmart Buffer):

T4 Polynucleotide Kinase (10 U/μL)

Nt.BbvCI (10 U/μL)

Nb.BbvCI (10 U/μL)

Exonuclease III (100 U/μL)

Exonuclease I (20 U/μL)

Phusion High-Fidelity DNA Polymerase (2 U/μL)

Taq DNA Ligase (40 U/μL)

DpnI (20 U/μL)

Materials:

Zymo Clean & Concentrator-5 kit (Zymo Research)

Corning square bioassay dishes, 245 mm x 245 mm x 25 mm (Sigma-Aldrich)

High-efficiency electrocompetent cells (e.g. Agilent XL1-Blue Electroporation Competent cells, #200228)

Thermal cycler

Kinase mutagenic oligos and secondary primer

Make a mixture of NNN/NNK mutagenic oligos at a final concentration of 10 μM.
Into a PCR tube, add: 20 μL 10 μM mutagenic oligo mixture

2.4 μL T4 Polynucleotide Kinase Buffer

1 μL 10 mM ATP

1 μL T4 Polynucleotide Kinase (10 U/μL)

In a separate PCR tube add: 18 μL NFH₂O

3 μL T4 Polynucleotide Kinase Buffer

7 μL 100 μM secondary primer

1 μL 10 mM ATP

1 μL T4 Polynucleotide Kinase (10 U/μL)

Incubate at 37°C for 1 hour. Store phosphorylated oligos at -20°C. The day of mutagenesis, dilute phosphorylated mutagenic oligos 1:1000 and secondary primer 1:20 in NFH₂O.

Prepare ssDNA template

Add the following into PCR tube(s): 0.76 pmol plasmid dsDNA

2 μL 10X CutSmart Buffer

1 μL 1:10 diluted Exonuclease III (final concentration of 10 U/μL)

1 μL Nt.BbvCI (10 U/μL)

1 μL Exonuclease I (20 U/μL)

NFH₂O to 20 μL final volume

Run the following PCR program: 37°C 60 minutes

80°C 80 minutes

4-10°C Hold

Single-site saturation mutagenesis strand 1

Add the following into each tube (100 μL final volume): 26.7 μL NFH₂O

20 μL 5X Phusion HF Buffer

4.3 μL 1:1000 diluted phosphorylated mutagenic oligos

20 μL 50 mM DTT

1 μL 50 mM NAD+

2 μL 10 mM dNTPs

1 μL Phusion High Fidelity Polymerase (2 U/μL)

5 μL Taq DNA Ligase (40 U/μL)

Run the following PCR program: 98°C 2 minutes

15 cycles of:

98°C 30 seconds

55°C 45 seconds

72°C 7 minutes

add additional 4.3 μL oligo at beginning of cycles 6 and 11

45°C 20 minutes

4-10°C Hold

Column purification I

Following the manufacturers' instructions, perform a column purification using a Zymo Clean and Concentrate Kit: a) Add 5 volumes of DNA binding buffer to each reaction and mix

b) Transfer to a Zymo-Spin Column in a collection tube

c) Centrifuge at maximum speed for 30 seconds and discard flow through

d) Add 200 μL of DNA wash buffer to the column

e) Centrifuge at maximum speed for 30 seconds and discard flow through

f) Repeat steps 4 and 5

g) Add 15 μL of NFH₂O directly to the column in a new clean 1.5 mL microfuge tube and incubate at room temperature for 5 minutes

h) Centrifuge at maximum speed for one minute

Degrade template strand

Transfer 14 μL of the purified DNA product to a PCR tube, then add (20 μL final volume): 2 μL 10X CutSmart Buffer

2 μL 1:50 diluted Exonuclease III (final concentration of 2 U/μL)

1 μL 1:10 Nb.BbvCI (final concentration of 1 U/μL)

1 μL Exonuclease I (20 U/μL)

Run the following PCR program: 37°C 60 minutes

80°C 20 minutes

4-10°C Hold

Synthesize 2^nd (complementary) mutagenic strand

To the above PCR tubes, add (100 μL final volume): 27.7 μL NFH₂O

20 μL 5X Phusion HF Buffer

3.3 μL 1:20 diluted phosphorylated secondary primer

20 μL 50 mM DTT

1 μL 50 mM NAD+

2 μL 10 mM dNTPs

1 μL Phusion High Fidelity Polymerase (2 U/μL)

5 μL Taq DNA Ligase (40 U/μL)

Run the following PCR program: 98°C 30 seconds

55°C 45 seconds

72°C 10 minutes

45°C 20 minutes

4-10°C Hold

DNA clean up

Add into each reaction 2 μL of DpnI (20 U/μL) and run the following PCR program: 60°C 60 minutes

Column purification II

Follow the instructions in step 9 but elute in 6 μL of NFH₂O.

DNA Transformation

Transform the entire 6 μL reaction product into a high-efficiency cloning strain following standard transformation protocols. After recovery, bring the final volume of the transformation to 2-2.5 mL with additional sterile media. Spread on to a prepared large BioAssay dish (245 mm x 245 mm x 25 mm, Sigma-Aldrich). Additionally, serial dilution plates should be prepared to calculate transformation efficiencies. Incubate overnight at 37°C. The next day, scrape the plate using 5-10 mL of LB or TB. Vortex the cell suspension and extract the library plasmid dsDNA using a mini-prep kit (Qiagen) of a 1 mL aliquot of the cell suspension. Additional mini-preps (or a midi-prep) can be done if large amounts of library DNA are required.

Please refer to Table 1.

One can expect 10⁵ and 10⁸ total transformants and roughly 70% mutational efficiency. The efficacy of this protocol has been demonstrated on multiple systems, and deep sequencing data to assess library composition of three different reactions can be found in Table 2.

We thank Adebola Adeniran and Keith Tyo of Northwestern University for testing this method. This work was supported by a graduate research fellowship from the MSU PBHS Biotechnology Training Program, grant number NIH-T32-GM110523 (to E.E.W.), and US National Science Foundation Career Award #1254238 CBET (to T.A.W.).

The authors have filed a provisional patent application (#62/380,717).

supplement0.xlsx
Table 1 Time required for nicking mutagenesis Estimated time required for comprehensive library construction using nicking mutagenesis. Steps follow numbering in Figure 1.
supplement0.xlsx
Table 2 Sample library coverage statistics Nicking mutagenesis coverage statistics

Download PDF

Version 1

posted

You are reading this latest protocol version

Nicking Mutagenesis: comprehensive single-site saturation mutagenesis

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Timing

Anticipated Results

Acknowledgements

Additional Declarations

Supplementary Files

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Nicking Mutagenesis: comprehensive single-site saturation mutagenesis

Status:

Version 1

Abstract

Figures

Introduction

Reagents

Equipment

Procedure

Timing

Anticipated Results

Acknowledgements

Additional Declarations

Supplementary Files

Associated Publications

Status:

Version 1

Privacy Policy

Terms of Service

Manage Cookie Preferences