Site specific mutagenesis can be used to generate mutants in specific residues. The method used here was originally developed by Kunkel (see ref. 1).
Method Article
Generation of deletion and insertion mutants
https://doi.org/10.1038/nprot.2007.85
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted 14 Feb, 2007
You are reading this latest protocol version
mutagenesis
insertion
deletion
Site specific mutagenesis can be used to generate mutants in specific residues. The method used here was originally developed by Kunkel (see ref. 1).
1) Clone AtAMT1;1 into pDRf1-GW using GATEWAYTM technology. Generate all amino acid substitutions by site-directed mutagenesis of the wild type AtAMT1;1 sequence1. Also generate AtAMT1;1 variants by site-directed
mutagenesis.
2) For the C-terminal truncation mutants, use single strand DNA of pDRf1-AtAMT1;1 as a template to insert a short DNA fragment coding for a stop codon and carrying XhoI restriction site (5’tgagtcgac).
3) Remove the remaining part of the Cterminus by XhoI digestion.
4) For all insertion mutants, use single stranded DNA from pDRf1-AtAMT1;1 carrying a 3x cmyc-tag at the very end of the AtAMT1;1 C-terminus as template.
5) Insert the C-terminal insertion of 5’atcgatggacgt, encoding IDGR, at positions 443, 444, 445, 446, 448, 455 or 456 into the AMT1;1 protein. For the L3-4 (Ins150) and L5-6 (Ins 231) insertions, insert a 5’ggttggagctcccgggggcgcc DNA fragment, encoding GGAPGGA, at position 150 or 231 into the AMT1;1 protein.
Insertions:
Ins150: …IAER_GGAPGGA_TQFV…
Ins231: …FDN_GGGAPGGA_GRAI…
Ins443: …ILKK_IDGR_LLRI…
Ins444: …LKKM_IDGR_KLLR…
Ins445: …KKMK_IDGR_LLRIS…
Ins446: …KMKL_IDGR_LRIS…
Ins448: …KLLR_IDGR_SSED…
Ins455: …EDEM_IDGR_AGMD…
Ins456: …DEMA_IDGR_GMD…
(1) Kunkel, T. A. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488-492 (1985).
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted 14 Feb, 2007
You are reading this latest protocol version
© Research Square 2022